Unlock instant, AI-driven research and patent intelligence for your innovation.

Vibrio parahaemolyticus phage VP-HYP2 and application thereof

A VP-HYP2, Vibrio hemolyticus technology, applied in the direction of bacteriophage, virus/phage, application, etc., can solve problems such as the environment that does not meet the sustainable development of fishery, pollution, drug resistance problems, etc., to reduce the number of bacteria and tolerate Wide-ranging, thermally stable effects

Active Publication Date: 2019-10-11
TAIZHOU UNIV
View PDF3 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Antibiotics are currently more effective drugs for the prevention and treatment of acute hepatopancreatic necrosis of prawns. However, the large and frequent use of antibiotics will cause problems of drug resistance and environmental pollution, which is no longer in line with the current sustainable development needs of fisheries.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vibrio parahaemolyticus phage VP-HYP2 and application thereof
  • Vibrio parahaemolyticus phage VP-HYP2 and application thereof
  • Vibrio parahaemolyticus phage VP-HYP2 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Isolation and identification of pathogenic Vibrio parahaemolyticus HY3 caused by acute hepatopancreatic necrosis of Penaeus vannamei

[0032] The diseased Penaeus vannamei was collected from a prawn farm, and the hepatopancreas of the diseased shrimp was dipped with an inoculation loop, streaked on a TCBS plate, and cultured at 30°C for 24 hours. On the next day, randomly pick a single green colony from the TCBS plate, and streak it on an LB plate with 3% sodium chloride to purify the single colony. Streak and purify the single colony repeatedly 4 times, and freeze the purified single colony in a glycerol tube at -80°C.

[0033] Thaw frozen colonies and extract genomes. Using the genome as a PCR template, primers PirAB-2020F (5'GCACCGTAAATTTTCAGGTT 3') and PirAB-2020R (5'CGTTGCAATCTAAGACATAG 3') were used to amplify the toxic genes pirA and pirB and their partial upstream and downstream sequences. The expected size band obtained by PCR amplification was sent...

Embodiment 2

[0035] Example 2 Pathogenicity identification of Vibrio parahaemolyticus HY3

[0036] The pathogenicity of bacterial strain HY3 was tested by soaking and challenge method, specifically as follows: Healthy Penaeus vannamei (about 1g) was taken from a nearby farm, and adapted to 4- 5d. There were 15 prawns in each group, and 3 parallel groups were set up; the experimental group was soaked in 1 (OD 600 ) artificial seawater, and the control group was soaked in artificial seawater without germs for 15 minutes. The soaked prawns were taken out, and the experimental group was transferred to the pathogen concentration of 0.01 (OD 600 ) of 3L seawater, the control group was transferred to 3L of pathogen-free artificial seawater. During the test period, feed, absorb dirt, and change water every day, record the mortality of prawns, observe 7 days after infection, and count the cumulative mortality of prawns. The result is as image 3 As shown in A, compared with the non-inoculated ...

Embodiment 3

[0037]Example 3 Isolation and identification of bacteriophage VP-HYP2

[0038] With acute hepatopancreatic necrosis pathogenic Vibrio parahaemolyticus HY3 as host bacteria, a phage was isolated from Taizhou vannamei culture wastewater by double-layer agar plate method. The phage has the nucleotide of SEQ ID No.1 Sequence representation of the genome, named Vibrio parahaemolyticus phage VP-HYP2. Using the negative staining method of phosphotungstic acid, the morphology of the phage was determined under the transmission electron microscope, as shown in Figure 4 shown.

[0039] In order to make the phage plaques of the phage on the plate more obvious and clear, 5% glycerol and 0.3 μg / ml tetracycline should be added to the double-layer agar plate.

[0040] The isolated and purified Vibrio parahaemolyticus phage VP-HYP2 was sent to the China Center for Type Culture Collection for preservation on April 3, 2019, the preservation number is: CCTCC NO: M 2019227, and the preservation...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a vibrio parahaemolyticus phage VP-HYP2 and application of the vibrio parahaemolyticus phage VP-HYP2 in prevention and control over pathogenic vibrio parahaemolyticus infectionof whiteleg shrimps, and belongs to the field of biotechnology. According to the vibrio parahaemolyticus phage VP-HYP2 and the application of the vibrio parahaemolyticus phage VP-HYP2, a double-layeragar plate method is utilized for separating a bacteriophage strain named the vibrio parahaemolyticus phage VP-HYP2 from wastewater generated from breeding of the whiteleg shrimps in Taizhou, and thepreservation number is CCTCCNO:M2019227. The provided vibrio parahaemolyticus phage VP-HYP2 is wide in pH tolerance range and high in thermostability, after the vibrio parahaemolyticus phage VP-HYP2is used for treating pathogenic vibrio parahaemolyticus causing acute hepatopancreatic necrosis of the shrimps, the number of bacteria is significantly reduced in a short time, and therefore the provided vibrio parahaemolyticus phage VP-HYP2 has a good application prospect in prevention and control over the pathogenic vibrio parahaemolyticus causing acute hepatopancreatic necrosis of the shrimps.

Description

technical field [0001] The invention relates to the field of biological technology, in particular to Vibrio parahaemolyticus phage VP-HYP2 and its application in preventing and treating pathogenic Vibrio parahaemolyticus infection of Penaeus vannamei. Background technique [0002] Penaeus vannamei is one of the main aquaculture species in my country and occupies an important position in the fishery economy. In recent years, the vannamei industry is facing severe acute hepatopancreas necrosis disease (AHPND), which has caused huge economic losses to the vannamei aquaculture industry. Studies have shown that the pathogenic bacteria of acute hepatopancreatic necrosis of Penaeus vannamei is mainly Vibrio parahaemolyticus with virulence genes pirA and pirB. [0003] Antibiotics are currently more effective drugs for the prevention and treatment of acute hepatopancreatic necrosis of prawns, but the large and frequent use of antibiotics will cause problems of drug resistance and e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/00A61K35/76A61P31/04A23K10/18A23K50/80A01N63/00A01P1/00C11D3/38C12R1/92
CPCA01N63/00A61K35/76A23K10/18A23K50/80A61P31/04C11D3/381C12N7/00C12N2795/00021
Inventor 钟永军黄若涵夏海洋
Owner TAIZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More