A kind of detection method of circulating tumor cells

A tumor cell and cell technology, which is applied to the analysis of circulating tumor cells, a kit for detecting circulating tumor cells, and the field of high-efficiency detection of rare cells in body fluids, can solve the problems of inconvenient use, low enrichment efficiency and high technical difficulty, Achieve great practicability, improve detection sensitivity, improve sensitivity and specificity

Active Publication Date: 2022-07-22
ZHIHUI MEDICAL TECH (SHANGHAI) CO LTD
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0014] On the whole, the traditional density gradient centrifugation method and cell size filtration method have fatal defects of low enrichment efficiency, the immunomagnetic bead positive enrichment method has shortcomings such as cumbersome operation, inconvenient use, and missed detection, while microfluidic chip technology has Disadvantages such as high cost and high technical difficulty

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of detection method of circulating tumor cells
  • A kind of detection method of circulating tumor cells
  • A kind of detection method of circulating tumor cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0109] Example 1: Detection and Analysis of Mock Samples of Healthy Human Peripheral Blood Incorporating Tumor Cell Lines

[0110] In this example, the peripheral blood of healthy people was used to mix HepG2 cells with gradient dilution, and the sample was used as a simulated sample for detection and analysis to evaluate the efficiency of this method for detecting tumors, that is, the recovery rate performance of this method. The specific details are as follows:

[0111] (1) Sample preparation

[0112] The HepG2 cells in the petri dish were digested and made into a single-cell suspension, which was counted with a red blood cell counter, diluted to an appropriate concentration with PBS, and carefully aspirated a certain number of tumor cells with a pipette. in peripheral blood to ensure quantitative accuracy.

[0113] (2) Specimen collection and pretreatment

[0114] The human peripheral blood sample was added with buffer and centrifuged for 5-10 minutes to remove plasma, th...

Embodiment 2

[0133] Example 2: CTC detection of clinical liver cancer blood samples

[0134] (1) Sample preparation

[0135] A total of 83 cases of liver cancer were clinically diagnosed in this group, of which 52 cases were histologically diagnosed. A total of 124 peripheral blood samples were collected.

[0136] (2) Sample detection

[0137] 7.5ml of the above blood sample was mixed by gentle inversion for several times, and then the number of circulating tumor cells was detected according to the steps in Example 1. We selected AFP as a specific marker for liver cancer, and designed the primer sequences as follows:

[0138] HCCAFP

[0139] GSS_F sequence (3'-5'): CCGTCGTAAAGAGGTTGTCC (SEQ ID NO: 1)

[0140] GSS_R sequence (3'-5'): CGACGAAAACCCTCAAATT (SEQ ID NO:2)

[0141] ID1 (3'-5'): ATCATG (SEQ ID NO: 3)

[0142] ID2 (3'-5'): TCTGAC (SEQ ID NO: 4)

[0143] G_R(3'-5'): GGCGACTTGGCGCACA (SEQ ID NO: 5)

[0144] G_F(3'-5'): GGTTACTGGGCTGCCT (SEQ ID NO:6)

[0145] (3) Analysis of...

Embodiment 3

[0169] Example 3: EMT-transformed prostate cancer CTC cells

[0170]Studies have found that CTCs can undergo epithelial-mesenchymal transition (EMT) behavior. EMT makes CTCs lose the phenotype of epithelial cells and acquire the phenotype of certain mesenchymal cells, showing stronger deformation and movement ability, so as to have the ability to invade through the surrounding basement membrane, make the cells lose the intercellular adhesion, and assist the CTCs Entering the blood system, these highly viable and highly metastatic tumor cells survive in the circulatory system, aggregate with each other to form tiny tumor thrombi, and develop into metastases under certain conditions. Researchers believe that 2.5% of CTCs can lead to micrometastases, which eventually lead to cancer recurrence or even death in patients. However, such CTC cells are extremely rare and difficult to capture.

[0171] (1) Sample preparation

[0172] A total of 150 prostate patients were collected in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detecting circulating tumor cells: collecting human body fluid samples, fixing with formaldehyde to increase cell membrane permeability, adding cells into several groups of PCR multiplex tubes, each tube is added with a reverse transcription primer carrying ID1, and reverse transcription After the cDNA molecules are recorded, the cells are collected and mixed into another set of PCR multiplex tubes. Each tube is added with an extension primer carrying ID2 and the 3' end can specifically recognize the 3' end of the cDNA molecule, and the extension reaction is carried out after sequence complementation. , cells were harvested and lysed, and extension products were pre-amplified by PCR primers. High-throughput sequencing to analyze the combination of ID1:ID2. Its advantages are: simultaneous reverse transcription and PCR amplification of different markers can accurately identify circulating tumor cells and circulating tumor cells with EMT, and can be used in combination with other technologies to detect the few circulating tumors in body fluid samples to the greatest extent. cells and other non-humoral rare cells.

Description

technical field [0001] The present invention relates to the technical field of cell detection, in particular, to a method for efficiently detecting rare cells in body fluids, in particular to a method for accurately detecting circulating tumor cells from blood, and to a method for detecting circulating tumor cells from blood A kit for detecting circulating tumor cells in peripheral blood of patients, an analysis method for circulating tumor cells and its application. Background technique [0002] Malignant tumors are one of the major diseases that seriously endanger human life and health. Finding methods capable of early diagnosis, prediction of metastasis and prognosis, and less invasiveness play an important role in improving the survival rate of such patients. In recent years, with the development of molecular biology technology, people's understanding of the molecular mechanism of tumor occurrence and development has gradually been enriched, and the clinical diagnosis an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N33/50
CPCG01N33/5044G01N33/50C12Q1/68
Inventor孙奋勇潘秋辉江赐忠吴棋黄楠崔中奇
OwnerZHIHUI MEDICAL TECH (SHANGHAI) CO LTD