A kind of detection method of circulating tumor cells
A tumor cell and cell technology, which is applied to the analysis of circulating tumor cells, a kit for detecting circulating tumor cells, and the field of high-efficiency detection of rare cells in body fluids, can solve the problems of inconvenient use, low enrichment efficiency and high technical difficulty, Achieve great practicability, improve detection sensitivity, improve sensitivity and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0109] Example 1: Detection and Analysis of Mock Samples of Healthy Human Peripheral Blood Incorporating Tumor Cell Lines
[0110] In this example, the peripheral blood of healthy people was used to mix HepG2 cells with gradient dilution, and the sample was used as a simulated sample for detection and analysis to evaluate the efficiency of this method for detecting tumors, that is, the recovery rate performance of this method. The specific details are as follows:
[0111] (1) Sample preparation
[0112] The HepG2 cells in the petri dish were digested and made into a single-cell suspension, which was counted with a red blood cell counter, diluted to an appropriate concentration with PBS, and carefully aspirated a certain number of tumor cells with a pipette. in peripheral blood to ensure quantitative accuracy.
[0113] (2) Specimen collection and pretreatment
[0114] The human peripheral blood sample was added with buffer and centrifuged for 5-10 minutes to remove plasma, th...
Embodiment 2
[0133] Example 2: CTC detection of clinical liver cancer blood samples
[0134] (1) Sample preparation
[0135] A total of 83 cases of liver cancer were clinically diagnosed in this group, of which 52 cases were histologically diagnosed. A total of 124 peripheral blood samples were collected.
[0136] (2) Sample detection
[0137] 7.5ml of the above blood sample was mixed by gentle inversion for several times, and then the number of circulating tumor cells was detected according to the steps in Example 1. We selected AFP as a specific marker for liver cancer, and designed the primer sequences as follows:
[0138] HCCAFP
[0139] GSS_F sequence (3'-5'): CCGTCGTAAAGAGGTTGTCC (SEQ ID NO: 1)
[0140] GSS_R sequence (3'-5'): CGACGAAAACCCTCAAATT (SEQ ID NO:2)
[0141] ID1 (3'-5'): ATCATG (SEQ ID NO: 3)
[0142] ID2 (3'-5'): TCTGAC (SEQ ID NO: 4)
[0143] G_R(3'-5'): GGCGACTTGGCGCACA (SEQ ID NO: 5)
[0144] G_F(3'-5'): GGTTACTGGGCTGCCT (SEQ ID NO:6)
[0145] (3) Analysis of...
Embodiment 3
[0169] Example 3: EMT-transformed prostate cancer CTC cells
[0170]Studies have found that CTCs can undergo epithelial-mesenchymal transition (EMT) behavior. EMT makes CTCs lose the phenotype of epithelial cells and acquire the phenotype of certain mesenchymal cells, showing stronger deformation and movement ability, so as to have the ability to invade through the surrounding basement membrane, make the cells lose the intercellular adhesion, and assist the CTCs Entering the blood system, these highly viable and highly metastatic tumor cells survive in the circulatory system, aggregate with each other to form tiny tumor thrombi, and develop into metastases under certain conditions. Researchers believe that 2.5% of CTCs can lead to micrometastases, which eventually lead to cancer recurrence or even death in patients. However, such CTC cells are extremely rare and difficult to capture.
[0171] (1) Sample preparation
[0172] A total of 150 prostate patients were collected in...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap