An anti-angptl3 monoclonal antibody and its use in the preparation of a medicine for treating nephrotic syndrome
A monoclonal antibody and nephrotic syndrome technology, which is applied in the field of anti-ANGPTL3 monoclonal antibody and the preparation of drugs for the treatment of nephrotic syndrome, can solve the problem of no functional antibody and achieve the effect of protecting podocytes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0020] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0021] The present invention uses the following reagents, cells and antibodies:
[0022]
[0023] The above reagents, cells, and antibodies are all commercially available products from Genescript Biotechnology Co., Ltd.
[0024] The sequence of the monoclonal antibody
[0025] A kind of anti-ANGPTL3 monoclonal antibody of the present invention, heavy chain DNA sequence (1392bp) (SEQ ID:No 3) is as follows:
[0026] ATGGCTGTCCTGGCACTGCTCCTCTGCCTGGTGACATTCCCAAGCTGTGTCCTGTCCCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCAGGGTTCTCATTAACCACCTATGGTGTAAGCTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGACGGGAACACAAATTATCATTCAGCTCTCATATCCAGACTGAGCATCAGCAAGGATAACTCCAAGAGCCAAGTTTTCTTAAAACTGAACAGTCTGCAAACTGATGACACAGCCACGTACTACTGTGCCAAAGGAGGACCCTATGGTAACTACGTGCCCTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAGCCAAAACGACACCCCCATCTGTCTAT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



