Gene encoding caulis spatholobi anthocyanidin reductase and application of gene
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of anthocyanin and reductase, which is applied to the gene encoding anthocyanin reductase of Galleria chinensis and its application field, can solve problems such as undiscovered research and report, and achieve the effects of increasing content and high application value.
Active Publication Date: 2020-06-05
GUANGXI BOTANICAL GARDEN OF MEDICINAL PLANTS
View PDF2 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, the ANR gene of Spatholobus has not been cloned yet, and no research or re
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0030] SsANR Gene Cloning
[0031] (1) RNA and DNA extraction: Trizol reagent (Invitrogen, USA) was used to extract total RNA from fresh young leaves of Mildew Spatholobus, and pretreated with RNase Free DNase (Promega, USA) to eliminate genomic DNA contamination. RNA integrity was analyzed on a 1.5% agarose gel, and RNA purity and concentration were determined spectrophotometrically.
[0032] The total DNA was extracted from the young leaves of Mildew Spatholobus by plant DNA kit (TIANGEN).
[0033] (2) Gene cloning: design primers according to the ANR sequence in the Genome of Spatholobus Spatholobus, use DNA as a template, and use Primer5.0 software to design gene-specific primers
[0034] F1: CGGATTTATGGCCTCTTG (SEQ ID NO: 4)
[0035] R1: TGACTTGATTCTCGCACC (SEQ ID NO: 5)
[0036] Through PCR amplification, a gDNA sequence with a length of 1996 bp was obtained, such as SEQ ID NO:1.
Embodiment 2
[0038] SsANR Gene Cloning
[0039] The RNA extracted in Example 1 was reverse-transcribed (AMV first strand cDNA synthesis kit: Roche, Switzerland), using the first strand cDNA as a template, using primers:
[0040] F1:TCTTTCCAGCTTGCTACACC (SEQ ID NO: 6)
[0041] R1: CTTTGAGGGACAATCTTCG (SEQ ID NO: 7)
[0042] Through PCR amplification, the cDNA sequence SEQ ID NO: 2 with a length of 644bp was obtained.
Embodiment 3
[0044] According to the translation of the cDNA sequence in Example 2, the amino acid sequence SEQ ID NO: 3 encoding anthocyanidin reductase (SsANR) of S. santiculata was obtained.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The present invention discloses a gene encoding caulis spatholobi anthocyanidin reductase and an application of the gene, and fills a gap of separating and cloning the anthocyanin reductase gene in the traditional Chinese medicinal material caulis spatholobi in China. The provided anthocyanin reductase gene has a nucleotide sequence shown in SEQ ID NO.1, or a homologous sequence with one or more added, substituted, inserted or deleted nucleotides or a nucleotide sequence of an allele and a derivative thereof. . A protein encoded by the gene has an amino acid sequence shown in SEQ ID NO.3 or ahomologous sequence with one or more added, substituted, inserted or deleted amino acids. The gene is expressed in roots, stems, leaves, flowers and fruits of caulis spatholobi, has higher expressionlevels in the roots and stems, and is very low in content in the leaves. The provided anthocyanin reductase helps to increase content of epicatechin in active components of the caulis spatholobi by using a genetic engineering technology and has a very good application prospect for improvement of germplasm resources of the caulis spatholobi in the future.
Description
technical field [0001] The present invention relates to the field of biotechnology, and relates to key enzymes and genes encoding them in the biosynthetic pathway of epicatechin, an active component of Milletera spatula, more specifically, the present invention relates to genes encoding anthocyanin reductases of Millipeda spatula and its application . Background technique [0002] Spatholobus suberectus Dunn is derived from the dried cane of the leguminous plant Spatholobus suberectus Dunn. It is used to treat irregular menstruation, dysmenorrhea, amenorrhea, rheumatic arthralgia, numbness and paralysis, blood deficiency and chlorosis, etc. It is widely used in Chinese patent medicines such as gynecology and rheumatic arthralgia. The research results show that the main active ingredients of Spatholobus Spatholobus are flavonoids, among which epicatechin is one of the main active ingredients. [0003] In the synthesis pathway of epicatechin, anthocyanidin reductase (ANR) ca...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more