Unlock instant, AI-driven research and patent intelligence for your innovation.

CD4 positive cell specific gene transfer vector and application thereof

A positive cell and specific technology, applied in the field of molecular pharmacology and molecular medicine, can solve the problems of unsatisfactory modification efficiency of specific targeting CD4 positive cells, reduction of rAAV vector production efficiency, and difficulty

Active Publication Date: 2021-01-15
HUAQIAO UNIVERSITY
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, using literature methods to modify the surface of rAAV vectors with ligands, the modification efficiency of aptamers that specifically target CD4-positive cells is not ideal. Clinically applied to CD4 + In vivo targeted gene delivery vectors for T cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CD4 positive cell specific gene transfer vector and application thereof
  • CD4 positive cell specific gene transfer vector and application thereof
  • CD4 positive cell specific gene transfer vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Plasmid pAAV is a plasmid carrying the whole gene of wild-type AAV2 virus (pCap / Rep, a gift from WeidongXiao Laboratory, Temple University, USA), wherein the Cap gene is responsible for encoding the capsid protein of AAV2 virus.

[0031] (1) Primer design

[0032] Such as figure 1 As shown, a total of 4 PCR primers for modifying AAV capsid were designed, as shown in SED ID NO: 27-30:

[0033] Primer F (TCAGGTGTTTACTGACTCGGAG, SED ID NO: 27);

[0034] Primer R (CGTCACACATACGACACCGG, SED ID NO: 28);

[0035] Primer R1 (TCTGTTGCCTCTCTGGAGGTTG, SED ID NO: 29);

[0036] Primer F1 (CAACCTCCAGAGAGGCAACAGANNNNNNNNNNNNNNNNNNNCAAGCAGCTACCGCAGATGTC, SED ID NO: 30), wherein 21 Ns refer to the inserted random fragment of 21 bases.

[0037] (2) Preparation of Fragment 1

[0038] Fragment 1 was amplified by PCR using plasmid pAAV as a template and primers F and R1 as paired primers.

[0039] (3) Preparation of Fragment 2

[0040] Fragment 2 was amplified by PCR using plasmid pA...

Embodiment 2

[0051] (1) Preparation of AAV capsid mutant library

[0052] 293 cells were inoculated in culture dishes and cultured overnight in DMEM medium containing 10% FBS until the confluence was about 80%.

[0053] Take 1 mL serum-free medium, add 8 μg pAAV-lib and 10 μg helper plasmid pFd6, mix gently, then add 1 mg / mL PEI solution at a ratio of 1:3, and vortex to mix. Add dropwise evenly to the culture medium of 293 cells, and at the same time shake gently to mix as soon as possible.

[0054] Place cells at 37 °C, 5% CO 2 16 hours after transfection, the old medium was discarded, and 10 mL of fresh DMEM medium containing 10% FBS was added.

[0055] Continue culturing in the cell incubator for 72 hours, collect the cells into a 15mL centrifuge tube, centrifuge at 1000g, 4°C for 15min, store the supernatant at 4°C, and resuspend the pellet with 1mL PBS solution into a 1.5mL centrifuge tube.

[0056] The collected cell suspension was frozen in a -80°C refrigerator for 1 hour, and th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular pharmaceutics and molecular medicine, in particular to a CD4 positive cell specific gene transfer vector and application thereof. The invention providesthe CD4 positive cell specific gene transfer vector. The transfer vector is a recombinant adeno-associated virus with a heptapeptide inserted into capsid protein of the recombinant adeno-associated virus (rAAV); and the amino acid sequence of the heptapeptide is shown as any one of SED ID NO: 1-26. According to the transfer vector, after the heptapeptide is inserted into the capsid protein of therAAV, the rAAV can efficiently deliver a transgenic element to a CD4 positive cell in a targeted mode. The transfer vector can selectively transduce the CD4 positive cell, the transgenic expression level is obviously higher than that of a wild rAAV2 vector, and effective targeted gene editing can be carried out.

Description

technical field [0001] The invention relates to the field of molecular medicine and molecular medicine, in particular to a CD4 positive cell-specific gene transfer carrier and its application. Background technique [0002] CD4 + T cells (ie, CD4-positive cells) are a type of immune cells that play an important role in the occurrence and development of many diseases, such as HIV infection / AIDS, various cancers, autoimmune diseases and allergic diseases. In addition, CD4 + CD8 + Different immune cells such as T cells, B cells and dendritic cells interact and play a key role in the coordination of immune responses. Therefore, CD4 + T cells are not only important target cells for understanding basic immunology, but also for gene therapy and immunotherapy. [0003] So far, for CD4 + The genetic modification of T cells is mainly based on the introduction of lentiviral vectors (LVs) in vitro. However, in vitro gene transfer requires operations such as cell isolation, long-te...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/864C07K7/06A61K48/00A61P31/18A61P35/02
CPCC12N15/86C07K7/06A61K48/005A61P31/18A61P35/02C12N2750/14143
Inventor 刁勇盛晓菁
Owner HUAQIAO UNIVERSITY