Unlock instant, AI-driven research and patent intelligence for your innovation.

Method and kit for detecting day age of pig reaching standard weight by utilizing pig chromosome 7

A chromosome and kit technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial assay/inspection, etc., to achieve the effects of low detection cost, long relief time, and low cost

Pending Publication Date: 2021-01-22
SHANGHAI XINNONG FEED
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the time period for the determination of the age of 100kg body weight is when the weight of the pig is in the range of 85-110kg. The traditional method can only be measured after the pig grows up.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for detecting day age of pig reaching standard weight by utilizing pig chromosome 7
  • Method and kit for detecting day age of pig reaching standard weight by utilizing pig chromosome 7
  • Method and kit for detecting day age of pig reaching standard weight by utilizing pig chromosome 7

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment one, the establishment of breeding method

[0027] 1. Determination of the g.41672433G>A polymorphic site of pig chromosome 7 (v11.1)

[0028] 1. PCR amplification

[0029] According to the upstream and downstream sequence information of pig chromosome 7 (v11.1) g.41672433G>A, a pair of primers were designed as follows:

[0030] U (upstream primer): 5'-TTGTTGTCGCACATCACCTTC-3' (see sequence 1 of the sequence listing);

[0031] D (downstream primer): 5'-GCCATACGGAGTAATCCTGAATG-3' (see sequence 2 of the sequence listing).

[0032] Two large white pigs were selected as experimental materials. Using large white pig genomic DNA as a template, PCR amplification was performed using primers U and D.

[0033] The amplification system is: Genomic DNA 200ng, 10×PCR amplification buffer 5μl, dNTPs 10mM, upstream and downstream primers 50ng each, TaqDNA polymerase 0.75U, Mg 2+ 2.5mmol / L, with ddH 2 O Supplement the reaction system to 50 μl.

[0034] The PCR reactio...

Embodiment 3

[0050] Based on the primer pair in Example 1:

[0051] Sequence 1: TTGTTGTCGCACATCACCTTC,

[0052] and sequence 2: GCCATACGGAGTAATCCTGAATG primer pair. Stabilizers or other reagents commonly used in nucleic acid reagents are added to prepare reagents for detecting pig No. 7 chromosome and assisting in detecting pigs up to 100 kg body weight in days. This reagent is available as a commercial product alone.

Embodiment 4

[0054] Based on the primer pair in Example 1:

[0055] Sequence 1: TTGTTGTCGCACATCACCTTC,

[0056] and sequence 2: GCCATACGGAGTAATCCTGAATG primer pair. The primers can be used in detection kits together with PCR-related reagents to make a kit for detecting pig chromosome 7 and assisting detection of pigs up to 100kg body weight day-old.

[0057]

[0058]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method and kit for detecting the day age of a pig reaching the standard weight by using pig chromosome 7, and particularly relates to the method for detecting the day age of the pig reaching 100 kg weight by using the chromosome 7. The method comprises the following steps: detecting whether deoxyribonucleotide at the 41672433 site of chromosome 7 (v11.1) of the pig is G orA, and then determining whether the genotype of the pig to be detected is GG or AA, wherein the day age of the pig with the GG genotype, reaching 100kg, is greater than the day age of the pig with the AA genotype, reaching 100kg. According to the method provided by the invention, the pig to be selected can be early screened, the problem of long time for selecting excellent breeding pigs in actualproduction is effectively relieved, the breeding cost is reduced, and the backfat character breeding progress of the pigs in actual production is effectively reduced or improved. The detection methodprovided by the invention is simple to operate, low in cost and high in accuracy, and can realize automatic direct detection. The method plays a great role in pig breeding work.

Description

technical field [0001] The invention relates to a method for detecting the age of a pig reaching the standard body weight by using pig No. 7 chromosome and a kit thereof, belonging to the field of biological detection. Background technique [0002] The age of pigs up to 100kg body weight is directly related to the economic benefits of the pig farm. Reducing the age of pigs up to 100kg body weight by one day can reduce the cost of raising pigs by about 5 yuan. Therefore, its value in breeding is very high, and it has always been the goal of pig breeding. An important part of. However, the determination period for reaching the age of 100kg body weight is that the pig body weight is in the range of 85-110kg, and the traditional method can only be measured after the pig grows up. On the one hand, the determination of its adulthood will increase the cost of breeding, on the other hand, it will lengthen the generation interval and slow down the speed of genetic progress. Early se...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6858C12N15/11
CPCC12Q1/6888C12Q1/6858C12Q2600/124C12Q2600/156C12Q2600/172C12Q2531/113C12Q2565/125
Inventor 宋欣李会智王双杨瑞生戚飞刘芳
Owner SHANGHAI XINNONG FEED