Method and kit for detecting day age of pig reaching standard weight by utilizing pig chromosome 7
A chromosome and kit technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial assay/inspection, etc., to achieve the effects of low detection cost, long relief time, and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Embodiment one, the establishment of breeding method
[0027] 1. Determination of the g.41672433G>A polymorphic site of pig chromosome 7 (v11.1)
[0028] 1. PCR amplification
[0029] According to the upstream and downstream sequence information of pig chromosome 7 (v11.1) g.41672433G>A, a pair of primers were designed as follows:
[0030] U (upstream primer): 5'-TTGTTGTCGCACATCACCTTC-3' (see sequence 1 of the sequence listing);
[0031] D (downstream primer): 5'-GCCATACGGAGTAATCCTGAATG-3' (see sequence 2 of the sequence listing).
[0032] Two large white pigs were selected as experimental materials. Using large white pig genomic DNA as a template, PCR amplification was performed using primers U and D.
[0033] The amplification system is: Genomic DNA 200ng, 10×PCR amplification buffer 5μl, dNTPs 10mM, upstream and downstream primers 50ng each, TaqDNA polymerase 0.75U, Mg 2+ 2.5mmol / L, with ddH 2 O Supplement the reaction system to 50 μl.
[0034] The PCR reactio...
Embodiment 3
[0050] Based on the primer pair in Example 1:
[0051] Sequence 1: TTGTTGTCGCACATCACCTTC,
[0052] and sequence 2: GCCATACGGAGTAATCCTGAATG primer pair. Stabilizers or other reagents commonly used in nucleic acid reagents are added to prepare reagents for detecting pig No. 7 chromosome and assisting in detecting pigs up to 100 kg body weight in days. This reagent is available as a commercial product alone.
Embodiment 4
[0054] Based on the primer pair in Example 1:
[0055] Sequence 1: TTGTTGTCGCACATCACCTTC,
[0056] and sequence 2: GCCATACGGAGTAATCCTGAATG primer pair. The primers can be used in detection kits together with PCR-related reagents to make a kit for detecting pig chromosome 7 and assisting detection of pigs up to 100kg body weight day-old.
[0057]
[0058]
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


