Kit for detecting rat peripheral blood HDAC5 expression level, and use method of kit
A technology of expression level and peripheral blood, applied in the field of peripheral blood detection, can solve problems such as cumbersome operation, and achieve the effect of highlighting substantive characteristics
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0040] A kit for detecting the expression level of HDAC5 in peripheral blood of rats, the reagents contained in the kit and instructions for use are shown in the following table:
[0041]
[0042] In the table: Primer Ⅰ: GTCGAAAGGATGGCACTGTT (upstream of HDAC5)
[0043] Primer II: AGCCAGTAAAGCCGTTCTCA (downstream of HDAC5)
[0044] Primer III: GGAGCGAGATCCCGTCAAGA (upstream of GAPDH)
[0045] Primer IV: CACAAACATGGGGGCATCAG (downstream of GAPDH).
[0046] A method for using the above-mentioned kit, which includes the following operation process:
[0047] Step 1: Isolation of Peripheral Blood Mononuclear Cells
[0048] Take 5mL of heparin anticoagulant blood, drip slowly along the tube wall and superimpose it into a test tube containing 5mL of solution a. Care should be taken to keep the interface between the two clear, centrifuge at 2000r / min for 20min at room temperature, and gently suck out with a capillary pipette. Milky white mononuclear cells;
[0049] Step 2: Ext...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap