High-yield iaa trichoderma viride engineering strain and its construction method and application
A construction method and technology of Trichoderma viride, applied in the field of microorganisms, can solve the problems of human health and living environment threats, contaminated soil, water and food, environmental pollution, etc., to improve the ability to produce IAA, promote application, and strengthen resistance to stress. and the effect of plant growth-promoting ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0081] Embodiment 1: the cloning of Trichoderma viride TvTRPS and TvTDC gene sequence and the construction of expression vector
[0082] (1) Cloning of TvTRPS and TvTDC gene expression cassettes
[0083] Genomic DNA of Trichoderma viride Tv-1511 was extracted according to the instructions of the Fungal Genome Extraction Kit (E.Z.N.AFungal DNA Kit, OMEGA, USA).
[0084] Using genomic DNA as a template, the complete sequence of the TvTRPS gene expression cassette was amplified, and the amplification primers were: TvTRPS-FL-EcoRI-Forward: CGGAATTCATGGCGATTATCAAGCAGA (SEQ ID NO.5) and TvTRPS-FL-KpnI-Reverse: GGGGTACCCTAAAAGCGAAGGTCCCAGC (SEQ ID NO.6).
[0085] Using genomic DNA as a template, the complete sequence of the TvTDC gene expression cassette was amplified, and the amplification primers were: TvTDC-FL-EcoRI-Forward: CGGAATTCATGGATACAGAACAGTTTCG (SEQ ID NO.7) and TvTDC-FL-KpnI-Reverse: GGGGTACCCTACTCCAGCTTCAACTG (SEQ ID NO.8).
[0086] Use the high-fidelity PCR polymera...
Embodiment 2
[0093] Example 2: Protoplast preparation and construction of overexpression engineering strains
[0094] (1) Protoplast preparation
[0095] Trichoderma viride Tv-1511 was inoculated on a PDA plate, and after culturing at 28°C for 10 days, a large amount of fresh conidia were produced; with 10mL of normal saline (0.9% NaCl, 0.05% Tween-20), the mycelial surface was washed, filtered through glass wool paper, Removing the mycelia to obtain a spore suspension;
[0096] Spread 200 μL of the spore suspension on a cellophane-covered PDA plate, and incubate at 28°C in the dark for 24 hours to germinate the spores on the PDA plate;
[0097] Preparation of lysing enzyme solution: Take 0.15 g of lysing enzyme (Lysing enzyme, Sigma: L1412) and dissolve it in 20 mL of solution I (1.2M D-sorbitol, 0.1M KH 2 PO 4 ,pH 5.6), 0.2μM membrane filter sterilization;
[0098] Take out the PDA plate, take out the fiber membrane with hyphae and stick it on the plate containing 3-4mL lysate, and t...
Embodiment 3
[0111] Embodiment 3: Utilize protoplast fusion technology to obtain the Trichoderma viride engineering strain of overexpressing TvTRPS gene and TvTDC gene simultaneously
[0112] Protoplasts of TvTRPS-OE and TvTDC-OE strains were prepared respectively as shown in Example 2 above. Subsequently, the two kinds of protoplasts were heat inactivated and UV inactivated, respectively.
[0113] The inactivation rate of protoplasts increased with the prolongation of treatment time. The inactivation rate of TvTRPS-OE protoplasts reached 100% after heat treatment at 55℃ for 25 minutes, and the inactivation rate of TvTDC-OE protoplasts reached 100% after UV treatment for 20 minutes.
[0114] The two inactivation solutions were mixed in equal volumes and added to PTC solution (PTC: 60% PEG4000, 10mM Tris-HCl, 10mM CaCl 2 , pH 7.5) to promote melting, 35 ° C water bath for 5 minutes, gradient dilution after centrifugation, mixed into the regeneration medium, 28 ° C constant temperature cult...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap