Supercharge Your Innovation With Domain-Expert AI Agents!

High-yield iaa trichoderma viride engineering strain and its construction method and application

A construction method and technology of Trichoderma viride, applied in the field of microorganisms, can solve the problems of human health and living environment threats, contaminated soil, water and food, environmental pollution, etc., to improve the ability to produce IAA, promote application, and strengthen resistance to stress. and the effect of plant growth-promoting ability

Active Publication Date: 2021-08-24
BIOLOGY INST OF SHANDONG ACAD OF SCI +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The abuse of chemical fertilizers has led to serious environmental pollution problems. The residues of pesticides and chemical fertilizers release a large amount of harmful substances to the environment, pollute soil, water and food, and pose a great threat to human health and living environment. New fertilizers that meet the sustainable development of agriculture are very necessary

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-yield iaa trichoderma viride engineering strain and its construction method and application
  • High-yield iaa trichoderma viride engineering strain and its construction method and application
  • High-yield iaa trichoderma viride engineering strain and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Embodiment 1: the cloning of Trichoderma viride TvTRPS and TvTDC gene sequence and the construction of expression vector

[0082] (1) Cloning of TvTRPS and TvTDC gene expression cassettes

[0083] Genomic DNA of Trichoderma viride Tv-1511 was extracted according to the instructions of the Fungal Genome Extraction Kit (E.Z.N.AFungal DNA Kit, OMEGA, USA).

[0084] Using genomic DNA as a template, the complete sequence of the TvTRPS gene expression cassette was amplified, and the amplification primers were: TvTRPS-FL-EcoRI-Forward: CGGAATTCATGGCGATTATCAAGCAGA (SEQ ID NO.5) and TvTRPS-FL-KpnI-Reverse: GGGGTACCCTAAAAGCGAAGGTCCCAGC (SEQ ID NO.6).

[0085] Using genomic DNA as a template, the complete sequence of the TvTDC gene expression cassette was amplified, and the amplification primers were: TvTDC-FL-EcoRI-Forward: CGGAATTCATGGATACAGAACAGTTTCG (SEQ ID NO.7) and TvTDC-FL-KpnI-Reverse: GGGGTACCCTACTCCAGCTTCAACTG (SEQ ID NO.8).

[0086] Use the high-fidelity PCR polymera...

Embodiment 2

[0093] Example 2: Protoplast preparation and construction of overexpression engineering strains

[0094] (1) Protoplast preparation

[0095] Trichoderma viride Tv-1511 was inoculated on a PDA plate, and after culturing at 28°C for 10 days, a large amount of fresh conidia were produced; with 10mL of normal saline (0.9% NaCl, 0.05% Tween-20), the mycelial surface was washed, filtered through glass wool paper, Removing the mycelia to obtain a spore suspension;

[0096] Spread 200 μL of the spore suspension on a cellophane-covered PDA plate, and incubate at 28°C in the dark for 24 hours to germinate the spores on the PDA plate;

[0097] Preparation of lysing enzyme solution: Take 0.15 g of lysing enzyme (Lysing enzyme, Sigma: L1412) and dissolve it in 20 mL of solution I (1.2M D-sorbitol, 0.1M KH 2 PO 4 ,pH 5.6), 0.2μM membrane filter sterilization;

[0098] Take out the PDA plate, take out the fiber membrane with hyphae and stick it on the plate containing 3-4mL lysate, and t...

Embodiment 3

[0111] Embodiment 3: Utilize protoplast fusion technology to obtain the Trichoderma viride engineering strain of overexpressing TvTRPS gene and TvTDC gene simultaneously

[0112] Protoplasts of TvTRPS-OE and TvTDC-OE strains were prepared respectively as shown in Example 2 above. Subsequently, the two kinds of protoplasts were heat inactivated and UV inactivated, respectively.

[0113] The inactivation rate of protoplasts increased with the prolongation of treatment time. The inactivation rate of TvTRPS-OE protoplasts reached 100% after heat treatment at 55℃ for 25 minutes, and the inactivation rate of TvTDC-OE protoplasts reached 100% after UV treatment for 20 minutes.

[0114] The two inactivation solutions were mixed in equal volumes and added to PTC solution (PTC: 60% PEG4000, 10mM Tris-HCl, 10mM CaCl 2 , pH 7.5) to promote melting, 35 ° C water bath for 5 minutes, gradient dilution after centrifugation, mixed into the regeneration medium, 28 ° C constant temperature cult...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a high-yield IAA Trichoderma viride engineering strain and a construction method and application thereof, belonging to the technical field of microorganisms. The present invention identifies genes encoding tryptophan synthase and tryptophan decarboxylase from the genome of Trichoderma viride Tv-1511, and successfully constructs a Trichoderma viride project that overexpresses TvTRPS and / or TvTDC. Bacteria (TvTRPS‑OE, TvTDC‑OE and TvTRPS / TDC‑OE), it has been proved by experiments that compared with the original Trichoderma original strain, the three constructed Trichoderma viride engineered bacteria have significantly enhanced IAA production capacity, and at the same time have more Strong stress resistance and plant growth-promoting ability can promote the application of Trichoderma in agricultural production, so it has good practical application value.

Description

technical field [0001] The invention belongs to the technical field of microbes, and in particular relates to a high-yield IAA engineering strain of Trichoderma viride and its construction method and application. Background technique [0002] The information disclosed in this background section is only intended to increase the understanding of the general background of the present invention, and is not necessarily taken as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to those skilled in the art. [0003] The abuse of chemical fertilizers has led to serious environmental pollution problems. The residues of pesticides and chemical fertilizers release a large amount of harmful substances to the environment, pollute soil, water and food, and pose a great threat to human health and living environment. New fertilizers that meet the sustainable development of agriculture are very necessary. There are a large number of gro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/60C12N15/55C12N9/88C12N9/16C12N15/80C12N15/10C12N15/66C12N1/15C12P17/10A01N63/38A01P21/00C12R1/885
CPCA01N63/38C12N9/16C12N9/88C12N15/66C12N15/80C12P17/10C12Y301/03012C12Y401/01028C12Y402/0102
Inventor 李哲张豪郭凯隋永辉黄艳华郝永任
Owner BIOLOGY INST OF SHANDONG ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More