Unlock instant, AI-driven research and patent intelligence for your innovation.

High-yield IAA Trichoderma viride engineering bacterial strain, and construction method and application thereof

A technology of Trichoderma viride and engineering bacteria, applied in the field of microorganisms, can solve the problems of polluted soil, water and food, human health and living environment threats, environmental pollution, etc., and achieve the effect of improving the application effect.

Active Publication Date: 2021-03-26
BIOLOGY INST OF SHANDONG ACAD OF SCI +1
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The abuse of chemical fertilizers has led to serious environmental pollution problems. The residues of pesticides and chemical fertilizers release a large amount of harmful substances to the environment, pollute soil, water and food, and pose a great threat to human health and living environment. New fertilizers that meet the sustainable development of agriculture are very necessary

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-yield IAA Trichoderma viride engineering bacterial strain, and construction method and application thereof
  • High-yield IAA Trichoderma viride engineering bacterial strain, and construction method and application thereof
  • High-yield IAA Trichoderma viride engineering bacterial strain, and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Embodiment 1: the cloning of Trichoderma viride TvTRPS and TvTDC gene sequence and the construction of expression vector

[0082] (1) Cloning of TvTRPS and TvTDC gene expression cassettes

[0083] Genomic DNA of Trichoderma viride Tv-1511 was extracted according to the instructions of the Fungal Genome Extraction Kit (E.Z.N.AFungal DNA Kit, OMEGA, USA).

[0084] Using genomic DNA as a template, the complete sequence of the TvTRPS gene expression cassette was amplified, and the amplification primers were: TvTRPS-FL-EcoRI-Forward: CGGAATTCATGGCGATTATCAAGCAGA (SEQ ID NO.5) and TvTRPS-FL-KpnI-Reverse: GGGGTACCCTAAAAGCGAAGGTCCCAGC (SEQ ID NO.6).

[0085] Using genomic DNA as a template, the complete sequence of the TvTDC gene expression cassette was amplified, and the amplification primers were: TvTDC-FL-EcoRI-Forward: CGGAATTCATGGATACAGAACAGTTTCG (SEQ ID NO.7) and TvTDC-FL-KpnI-Reverse: GGGGTACCCTACTCCAGCTTCAACTG (SEQ ID NO.8).

[0086] Use the high-fidelity PCR polymera...

Embodiment 2

[0093] Example 2: Protoplast preparation and construction of overexpression engineering strains

[0094] (1) Protoplast preparation

[0095] Trichoderma viride Tv-1511 was inoculated on a PDA plate, and after culturing at 28°C for 10 days, a large amount of fresh conidia were produced; with 10mL of normal saline (0.9% NaCl, 0.05% Tween-20), the mycelial surface was washed, filtered through glass wool paper, Removing the mycelia to obtain a spore suspension;

[0096] Spread 200 μL of the spore suspension on a cellophane-covered PDA plate, and incubate at 28°C in the dark for 24 hours to germinate the spores on the PDA plate;

[0097] Preparation of lysing enzyme solution: Take 0.15 g of lysing enzyme (Lysing enzyme, Sigma: L1412) and dissolve it in 20 mL of solution I (1.2M D-sorbitol, 0.1M KH 2 PO 4 ,pH 5.6), 0.2μM membrane filter sterilization;

[0098] Take out the PDA plate, take out the fiber membrane with hyphae and stick it on the plate containing 3-4mL lysate, and t...

Embodiment 3

[0111] Embodiment 3: Utilize protoplast fusion technology to obtain the Trichoderma viride engineering strain of overexpressing TvTRPS gene and TvTDC gene simultaneously

[0112] Protoplasts of TvTRPS-OE and TvTDC-OE strains were prepared respectively as shown in Example 2 above. Subsequently, the two kinds of protoplasts were heat inactivated and UV inactivated, respectively.

[0113] The inactivation rate of protoplasts increased with the prolongation of treatment time. The inactivation rate of TvTRPS-OE protoplasts reached 100% after heat treatment at 55℃ for 25 minutes, and the inactivation rate of TvTDC-OE protoplasts reached 100% after UV treatment for 20 minutes.

[0114] The two inactivation solutions were mixed in equal volumes and added to PTC solution (PTC: 60% PEG4000, 10mM Tris-HCl, 10mM CaCl 2 , pH 7.5) to promote melting, 35 ° C water bath for 5 minutes, gradient dilution after centrifugation, mixed into the regeneration medium, 28 ° C constant temperature cult...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a high-yield IAA Trichoderma viride engineering bacterial strain, and a construction method and application thereof, and belongs to the technical field of microorganisms. Encoding genes which independently encode tryptophane synthase and tryptophane decarboxylase are authenticated from the genome of the (Trichoderma viride) Tv-1511, and Trichoderma viride engineering bacteria (TvTRPS-OE, TvTDC-OE and TvTRPS / TDC-OE) subjected to TvTRPS and / or TvTDC overexpression are successfully constructed. An experiment proves that compared with an original Trichoderma spp. bacterialstrain, the IAA production capacity of the constructed three types of Trichoderma viride engineering bacteria is obviously enhanced, meanwhile, the three types of Trichoderma viride engineering bacteria have a higher stress resistance and plant growth promotion capacity, application of the Trichoderma spp. bacteria in industrial production can be accelerated, and therefore, the three types of Trichoderma viride engineering bacteria have a good practical application value.

Description

technical field [0001] The invention belongs to the technical field of microbes, and in particular relates to a high-yield IAA engineering strain of Trichoderma viride and its construction method and application. Background technique [0002] The information disclosed in this background section is only intended to increase the understanding of the general background of the present invention, and is not necessarily taken as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to those skilled in the art. [0003] The abuse of chemical fertilizers has led to serious environmental pollution problems. The residues of pesticides and chemical fertilizers release a large amount of harmful substances to the environment, pollute soil, water and food, and pose a great threat to human health and living environment. New fertilizers that meet the sustainable development of agriculture are very necessary. There are a large number of gro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/60C12N15/55C12N9/88C12N9/16C12N15/80C12N15/10C12N15/66C12N1/15C12P17/10A01N63/38A01P21/00C12R1/885
CPCA01N63/38C12N9/16C12N9/88C12N15/66C12N15/80C12P17/10C12Y301/03012C12Y401/01028C12Y402/0102
Inventor 李哲张豪郭凯隋永辉黄艳华郝永任
Owner BIOLOGY INST OF SHANDONG ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More