Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Separated lettuce Tr gene and application thereof in controlling allergic reaction of lettuce to triazinam

A technology of allergic reaction and azithromycin, applied in the field of plant engineering, can solve the problem of unreported molecular mechanism of type

Active Publication Date: 2021-04-30
HUAZHONG AGRI UNIV
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, neither the type nor the molecular mechanism of the genes controlling the allergic response of lettuce to azinamide have been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Separated lettuce Tr gene and application thereof in controlling allergic reaction of lettuce to triazinam
  • Separated lettuce Tr gene and application thereof in controlling allergic reaction of lettuce to triazinam
  • Separated lettuce Tr gene and application thereof in controlling allergic reaction of lettuce to triazinam

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Acquisition of the gene Tr controlling lettuce hypersensitivity to azinamide:

[0027] 1. Genetic analysis of lettuce hypersensitivity to azinamine

[0028] In order to analyze the genetic law of the genes controlling the allergic reaction of lettuce to azinamide, the present invention adopts romaine lettuce (Romaine, PI344074) sensitive to azinamide and head lettuce (Crisphead, PI536839) insensitive to azinamide as parents ( figure 1 ), to obtain F by crossing 1 , further selfing to obtain F 2 generation groups (Yu et al. 2020). to F 2 On behalf of the individual, the phenamine solution was processed and the phenotype after 24 hours was evaluated, recorded and statistically analyzed. F in 179 individuals 2 The number of individuals with a sensitive phenotype in the population is 134, and the number of individuals with an insensitive phenotype is 45. Sensitive individuals: insensitive individuals = 134:45≈3:1(χ 2 =0.01282 (0.05,1)=3.84, P>0.05). It was shown tha...

Embodiment 2

[0032] Application of the gene Tr controlling the allergic reaction of lettuce to azinamide in lettuce:

[0033](1) Using sensitive romaine lettuce (Romaine, PI344074) DNA as a template, using primers: AGHP544F: GATATATTTCTCAAGATCAGAAGTACTAATTAAAGGGTTTGGAATTGAAA and AGHP544F: TTGAACGATCGGGGAAATTCGAGCTCTTACACATAAGACATGACAA, the amplified target fragment contains the sequence shown in SEQ ID NO. It was inserted into the pRI101 plant expression vector (the vector was linearized with SacI / ScaI) and transformed into insensitive lettuce (tr / tr) under Agrobacterium-mediated (Curtis et al. 1994). Transgenic detection primers were used: AGHP538F: CTTCTGTAAAAGGATCATGCC; AGHP538R: CTTGACATCTTCTTCACTTG to detect transgenic plants, and a total of 4 transgenic plants were obtained, and each strain showed a phenotype sensitive to azinamide ( image 3 Middle (a) the second from the left shows the phenotype of one of the transgenic plants Tr-COM#1 sensitive to azinamide). T for one of the tra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant engineering, and discloses a separated lettuce Tr gene and an application of the lettuce Tr gene in controlling the allergic reaction of lettuce to triazinam. The nucleotide sequence of the gene is as shown in SEQ ID NO. 1. Through agrobacterium-mediated transformation of the Tr gene into the insensitive lettuce, the result shows that the Tr can transform the insensitive lettuce into the lettuce sensitive to the triazinam. The result of knocking out the Tr gene from the sensitive lettuce by virtue of a CRISPR-Cas9 technology shows that the sensitive lettuce becomes insensitive by virtue of Tr. Tr is the first gene identified in lettuce and used for controlling the allergic reaction of lettuce to triazinam, and a new experimental material and a new research method are provided for research of plant allergic reaction and disease-resistant biological pathways. Meanwhile, the Tr gene can be used as a carrier selection marker and can also be applied to large-scale efficient screening of transgenic offspring marker-free individuals.

Description

technical field [0001] The invention belongs to the technical field of plant engineering, and in particular relates to an isolated lettuce Tr gene and its application in controlling the allergic reaction of lettuce to azinamine. Background technique [0002] Lettuce (Lactuca sativa L.) is a plant of the genus Lactuca in the Asteraceae family. It is native to the Mediterranean region and is an important vegetable crop in my country. According to its different shapes and edible parts, lettuce can be further divided into leaf lettuce (ie lettuce, Lactuca sativaLinn.var.ramosa Hort.), stem lettuce (ie lettuce, Lactuca sativaLinn.var. angustata Irish ex Bremer). Lettuce can be further divided into Romaine, Crisphead, Looseleaf, Butterhead, etc. (Zhang et al. 2017). Some lettuce germplasm, especially Romaine germplasm, exhibited hypersensitivity to the fungicide azinamide, and necrotic spots developed on the allergic lettuce within 24 hours after spraying with azinamide solutions...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/14C12Q1/6895
CPCC07K14/415C12N15/8218C12N15/8271C12Q1/6895C12Q2600/13
Inventor 匡汉晖安光辉陈炯炯张维奕余长春
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com