Conjugated protein containing NT-proBNP antigen conjugating structural domain
A technology for binding domains and binding proteins, applied in the field of isolated binding proteins, can solve the problems of poor activity and low affinity, and achieve the effects of high affinity, strong activity and excellent affinity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0145] 1. Expression plasmid construction
[0146] In this example, the restriction endonuclease and Prime Star DNA polymerase were purchased from Takara Company. MagExtractor-RNA extraction kit was purchased from TOYOBO Company. BD SMART TM RACE cDNA Amplification Kit was purchased from Takara Company. The pMD-18T vector was purchased from Takara Company. Plasmid extraction kit was purchased from Tiangen Company. Primer synthesis and gene sequencing were performed by Invitrogen. The hybridoma cell line that secretes the Anti-NT-proBNP 7A5 monoclonal antibody is an existing hybridoma cell line of our company, and it is recovered for use.
[0147] 1.1. Primers
[0148] Amplify Heavy Chain and Light Chain 5'RACE Primers:
[0149] SMARTER II A Oligonucleotide:
[0150] 5'>AAGCAGTGGTATCAACGCAGAGGTACXXXXX<3';
[0151] 5'-RACE CDS Primer (5'-CDS): 5'>(T) 25 VN<3 (N=A, C, G, orT; V=A, G, orC);
[0152] Universal Primer A Mix (UPM):
[0153] 5'>CTAATACGACTCACTATAGGGCAAGCA...
Embodiment 2
[0185] 2.1 Site Mutation Antibody
[0186] The antibody obtained in Example 1 has light chains and heavy chains with sequences as shown in SEQ ID NO: 11 and 12 after analysis, which has a certain ability to bind NT-proBNP protein, and has a better affinity. For further screening, the antibody with better affinity For an antibody, the applicant mutates the light chain CDR and the heavy chain CDR of the antibody.
[0187] After analysis, the complementarity determining region (WT) of the heavy chain:
[0188] CDR-VH1 is G-Y-F(X1)-F-T-E(X2)-Y-Y-I-Q(X3);
[0189] CDR-VH2 is W-I-Q(X1)-P-E-D(X2)-F-N-V(X3)-E-Y-N-E-R(X4)-F-K-G;
[0190] CDR-VH3 is A-K(X1)-D-A(X2)-D-W-E(X3)-G-D;
[0191] Complementarity determining region (WT) of the light chain:
[0192] CDR-VL1 is R-T(X1)-S-Q-S-I(X2)-L(X3)-H-R(X4)-N-G-N-T-Y-L-H;
[0193] CDR-VL2 is K-V(X1)-S-E(X2)-R-F-S;
[0194] CDR-VL3 is T(X1)-Q-T(X2)-T-H-V(X3)-P-P-T;
[0195] Among them, X1, X2, X3, and X4 are mutation sites.
[0196] Tab...
PUM
| Property | Measurement | Unit |
|---|---|---|
| affinity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


