Unlock instant, AI-driven research and patent intelligence for your innovation.

Conjugated protein containing NT-proBNP antigen conjugating structural domain

A technology for binding domains and binding proteins, applied in the field of isolated binding proteins, can solve the problems of poor activity and low affinity, and achieve the effects of high affinity, strong activity and excellent affinity

Active Publication Date: 2021-05-04
DONGGUAN PENGZHI BIOTECH CO LTD
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently commonly used NT-proBNP-binding proteins have problems such as poor activity and low affinity, and cannot be well applied to the detection of NT-proBNP. Therefore, there is a strong demand for NT-proBNP-binding proteins with good activity and high affinity in this field.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Conjugated protein containing NT-proBNP antigen conjugating structural domain
  • Conjugated protein containing NT-proBNP antigen conjugating structural domain
  • Conjugated protein containing NT-proBNP antigen conjugating structural domain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0145] 1. Expression plasmid construction

[0146] In this example, the restriction endonuclease and Prime Star DNA polymerase were purchased from Takara Company. MagExtractor-RNA extraction kit was purchased from TOYOBO Company. BD SMART TM RACE cDNA Amplification Kit was purchased from Takara Company. The pMD-18T vector was purchased from Takara Company. Plasmid extraction kit was purchased from Tiangen Company. Primer synthesis and gene sequencing were performed by Invitrogen. The hybridoma cell line that secretes the Anti-NT-proBNP 7A5 monoclonal antibody is an existing hybridoma cell line of our company, and it is recovered for use.

[0147] 1.1. Primers

[0148] Amplify Heavy Chain and Light Chain 5'RACE Primers:

[0149] SMARTER II A Oligonucleotide:

[0150] 5'>AAGCAGTGGTATCAACGCAGAGGTACXXXXX<3';

[0151] 5'-RACE CDS Primer (5'-CDS): 5'>(T) 25 VN<3 (N=A, C, G, orT; V=A, G, orC);

[0152] Universal Primer A Mix (UPM):

[0153] 5'>CTAATACGACTCACTATAGGGCAAGCA...

Embodiment 2

[0185] 2.1 Site Mutation Antibody

[0186] The antibody obtained in Example 1 has light chains and heavy chains with sequences as shown in SEQ ID NO: 11 and 12 after analysis, which has a certain ability to bind NT-proBNP protein, and has a better affinity. For further screening, the antibody with better affinity For an antibody, the applicant mutates the light chain CDR and the heavy chain CDR of the antibody.

[0187] After analysis, the complementarity determining region (WT) of the heavy chain:

[0188] CDR-VH1 is G-Y-F(X1)-F-T-E(X2)-Y-Y-I-Q(X3);

[0189] CDR-VH2 is W-I-Q(X1)-P-E-D(X2)-F-N-V(X3)-E-Y-N-E-R(X4)-F-K-G;

[0190] CDR-VH3 is A-K(X1)-D-A(X2)-D-W-E(X3)-G-D;

[0191] Complementarity determining region (WT) of the light chain:

[0192] CDR-VL1 is R-T(X1)-S-Q-S-I(X2)-L(X3)-H-R(X4)-N-G-N-T-Y-L-H;

[0193] CDR-VL2 is K-V(X1)-S-E(X2)-R-F-S;

[0194] CDR-VL3 is T(X1)-Q-T(X2)-T-H-V(X3)-P-P-T;

[0195] Among them, X1, X2, X3, and X4 are mutation sites.

[0196] Tab...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
affinityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a separate conjugated protein containing a NT-proBNP antigen conjugating structural domain and researches in the aspects of preparation and application of the conjugated protein. The conjugated protein is high in activity, has relatively high affinity with NT-proBNP, can achieve efficient detection on the NT-proBNP and thus can provide a foundation for early diagnosis on heart failure.

Description

technical field [0001] The invention relates to the fields of biotechnology and medical technology, in particular to an isolated binding protein comprising NT-proBNP antigen binding domain and application thereof. Background technique [0002] Brain Natriuretic Peptide (BNP), a polypeptide hormone with powerful diuretic, vasodilator and hypotensive effects. BNP has the highest content in the heart and is secreted by the ventricle. Myocardium first synthesizes proBNP (precursor of BNP) containing 108 amino acids. The biologically inactive amino-terminal pro-B-type natriuretic peptide (NT-proBNP) and the active B-type natriuretic peptide (BNP) containing 32 amino acids are secreted and released into the blood circulation in equimolar proportions. [0003] At present, it is believed that brain natriuretic peptide (BNP) and pro-BNP N-terminal peptide (NT-proBNP) are biomarkers for judging heart failure. (NT-proBNP) and the index concentration of BNP will increase abnormally. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/26C12N15/13C12N5/10G01N33/74G01N33/68
CPCC07K16/26G01N33/74G01N33/6893C07K2317/92C07K2317/565C07K2317/94G01N2333/58G01N2800/325
Inventor 崔鹏何志强孟媛钟冬梅叶庆妮覃婷游辉
Owner DONGGUAN PENGZHI BIOTECH CO LTD