Unlock instant, AI-driven research and patent intelligence for your innovation.

A compound for treating optic nerve disease and its preparation method and use

A complex and optic nerve technology, applied in the field of biomedicine, can solve the problems of the protection effect of DNA tetrahedron on the optic nerve, the use of compound, and the undisclosed use of miR-22, etc., and achieve good application prospects and promote release. Effect

Active Publication Date: 2022-07-12
CHENGDU GENREZE GENE TECH CO LTD
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Chinese patent CN109806275A discloses the use of DNA tetrahedron to promote the proliferation, differentiation and / or migration of neural stem cells, but does not disclose the effect of DNA tetrahedron on optic nerve protection
Romano et al disclosed that miR-22 is a predictive target gene for glaucoma, however, the use of miR-22 as a target gene for treatment of glaucoma has not been disclosed (Romano GL, Platania CB, Forte S, Salomone S, Drago F, Bucolo C. MicroRNA target prediction in glaucoma. Prog Brain Res. 2015; 220:217-40.)
[0007] To sum up, there are still no relevant reports on the use of DNA tetrahedron or miR-22 in the treatment of glaucoma, let alone the combined use of the two as optic nerve protection drugs to treat glaucoma.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A compound for treating optic nerve disease and its preparation method and use
  • A compound for treating optic nerve disease and its preparation method and use
  • A compound for treating optic nerve disease and its preparation method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1. Synthesis of the complex of tFNA and miR-22 (tFNA-miR22)

[0049] 1. Synthesis

[0050] Dissolve the four DNA single strands (S1, S2, S3-miR22, S4) in TM Buffer (10mM Tris-HCl, 50MmMgCl2, pH=8.0), the final concentration of the four DNA single strands is 1000nM, mix well, and heat rapidly to 95°C for 10 minutes, then rapidly cooled to 4°C and maintained for more than 20 minutes to obtain tFNA-miR22.

[0051] The sequence of the four single strands (5'→3') is as follows:

[0052] S1:

[0053] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA

[0054] (SEQ ID NO. 1)

[0055] S2:

[0056] ACATGCGAGGGTCCAATACCGACGATTACAGCTTTGCTACACGATTCAGACTTAGGAATGTTCG

[0057] (SEQ ID NO. 2)

[0058] S3-miR22-3p:

[0059] AAGCUGCCAGUUGAAGAACUGU-TTTTT-ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC

[0060] S4:

[0061] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG

[0062] (SEQ ID NO. 4)

[0063] The 5' end of S1 is op...

experiment example 1

[0070] Experimental Example 1. Uptake of tFNA-miR22 by injured retinal ganglion cells

[0071] 1. Experimental method

[0072] 1.1 Testing the optimal modeling concentration (simulating optic ganglion cell damage in vitro)

[0073] RGC-5 cells (a mouse retinal ganglion cell) were grouped and cultured in 96-well plates, 1*10 per well 4 cells. Each group was treated with different concentrations of N-methyl-D-aspartic acid (NMDA) for 1 h, then changed to complete medium and continued to culture for 24 h. Then, the cell activity was detected by CCK-8 experiment, and the drug inhibition rate of 4 mM NMDA was found. is about 40%, so 4mM was chosen as the optimal modeling concentration (such as Image 6 :A-B).

[0074] 1.2 Test the optimal anti-cell damage drug concentration (cell proliferation experiment)

[0075] RGC-5 cells were grouped and cultured in 96-well plates, 1*10 per well 4 cells. After adding 4nM NMDA to each experimental group except the blank group and treatin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a complex tFNA-miR22 for treating optic nerve diseases, which is composed of DNA tetrahedron and miR-22 in a molar ratio of 1:(1-4). The tFNA-miR22 of the present invention can effectively inhibit the apoptosis of retinal ganglion cells, and promote the release of brain-derived neural factor (BDNF), thereby having a good protective effect on retinal ganglion cells. The use of tFNA‑miR22 to prepare optic nerve protective drugs will help in the treatment of neurodegenerative optic nerve diseases including glaucoma, and has a very good application prospect.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a compound for treating optic nerve diseases and a preparation method and application thereof. Background technique [0002] Glaucoma is a group of diseases that threaten and damage the optic nerve and its visual pathway and cause visual dysfunction. It is the world's first irreversible blinding eye disease. Primary open-angle glaucoma is a special type of optic nerve disease characterized by progressive damage to retinal ganglion cells (RGCs) and their axons, with characteristic optic atrophy and visual field defect. . Glaucoma is often insidious onset and progresses slowly. There are generally no obvious symptoms in the early stage, and the visual field gradually shrinks until blindness. There are nearly 21 million glaucoma patients in my country, which will likely result in nearly 6.3 million blind people and more than 10 million visually impaired people. [0003] The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K31/711A61K31/7105A61P27/06A61P25/02
CPCA61K31/711A61K31/7105A61P27/06A61P25/02A61K2300/00C12N15/113C12N2310/151C12N2310/3519C12N2310/141
Inventor 林云锋李佳杰蔡潇潇
Owner CHENGDU GENREZE GENE TECH CO LTD