Unlock instant, AI-driven research and patent intelligence for your innovation.

Enhanced MMLV reverse transcriptase mutant and application thereof

A reverse transcriptase and mutant technology, applied in the field of enhanced MMLV reverse transcriptase mutants, can solve the problems of restricting trace RNA viruses, affecting the detection of RNA molecules, and the inability of RNA to perform effective reverse transcription, and achieve strong reverse transcription capabilities. Effect

Active Publication Date: 2021-07-27
YEASEN BIOTECHNOLOGY (SHANGHAI) CO LTD
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Very low concentrations of RNA samples are often encountered in molecular testing. Ordinary reverse transcriptases cannot perform effective reverse transcription on such extremely low concentrations of RNA, which affects the detection of RNA molecules in samples and severely limits the detection of trace RNA viruses. , single-cell RNA analysis and other application technology development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Enhanced MMLV reverse transcriptase mutant and application thereof
  • Enhanced MMLV reverse transcriptase mutant and application thereof
  • Enhanced MMLV reverse transcriptase mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] MMLV reverse transcriptase mutants, the following sites of wild-type MMLV were mutated: A70K; S142P; E201N; D206R; G248D; L300K; A307K; G331P;

[0014] Referring to the Smart-seq2 single-cell mRNA full-length amplification protocol, use this mutant reverse transcriptase to perform reverse transcription of trace RNA and use Yeasen high-fidelity enzyme Super Ⅱ Amplify the reverse transcription product, and the amplified product uses Hieff DNA Selection Beads were used for purification, and the purified product was analyzed for product size using the Agilent High Sensitivity DNA Kit. Experimental operations were performed in ultra-clean benches to avoid contamination.

[0015] Table 1: Primers used for single cell library construction

[0016] TSO 5′-AAGCAGTGGTATCAACGCAGAGTACATrGrG+G-3′ Oligo-dT30VN 5′ – AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3′

[0017] The above synthesized primers were diluted to 100 μM with 1×TE Buffer (nuclease-free), and then aliqu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an enhanced MMLV reverse transcriptase mutant, which is characterized in that 16 amino acid sites are mutated on the amino acid sequence (as shown in SEQ ID No.1) of MMLV reverse transcriptase in a wild type, and the amino acid mutation sites are as follows: A70K, S142P, E201N, D206R, G248D, L300K, A307K, G331P, I434R, S453K, Y522G, E531G, E574G, E596G, E610G, and E645G. The MMLV enhanced MMLV reverse transcriptase mutant disclosed by the invention has stronger reverse transcription capability, can be used for effective reverse transcription of micro RNA, and can be applied to the fields of single cell transcriptase library building, micro RNA virus detection and the like.

Description

technical field [0001] The patent of the invention relates to an enhanced MMLV reverse transcriptase mutant and its application, and belongs to the field of biotechnology. Background technique [0002] Very low concentrations of RNA samples are often encountered in molecular testing. Ordinary reverse transcriptases cannot perform effective reverse transcription on such extremely low concentrations of RNA, which affects the detection of RNA molecules in samples and severely limits the detection of trace RNA viruses. , single-cell RNA analysis and other application technology development. Contents of the invention [0003] The object of the present invention is to provide a kind of enhanced MMLV reverse transcriptase mutant, carry out mutation to the following all 16 sites of wild-type MMLV reverse transcriptase amino acid sequence (SEQ ID No.1): A70K; S142P; E201N; D206R ; G248D; L300K; A307K; G331P; I434R; S453K; Y522G; E531G; E574G; E596G; [0004] Another object of the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/12C12Q1/686
CPCC12N9/1276C12Q1/686C12Y207/07049C12Q2521/107Y02A50/30
Inventor 罗秉轮戴广伟曹振
Owner YEASEN BIOTECHNOLOGY (SHANGHAI) CO LTD