Enhanced MMLV reverse transcriptase mutant and application thereof
A reverse transcriptase and mutant technology, applied in the field of enhanced MMLV reverse transcriptase mutants, can solve the problems of restricting trace RNA viruses, affecting the detection of RNA molecules, and the inability of RNA to perform effective reverse transcription, and achieve strong reverse transcription capabilities. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0013] MMLV reverse transcriptase mutants, the following sites of wild-type MMLV were mutated: A70K; S142P; E201N; D206R; G248D; L300K; A307K; G331P;
[0014] Referring to the Smart-seq2 single-cell mRNA full-length amplification protocol, use this mutant reverse transcriptase to perform reverse transcription of trace RNA and use Yeasen high-fidelity enzyme Super Ⅱ Amplify the reverse transcription product, and the amplified product uses Hieff DNA Selection Beads were used for purification, and the purified product was analyzed for product size using the Agilent High Sensitivity DNA Kit. Experimental operations were performed in ultra-clean benches to avoid contamination.
[0015] Table 1: Primers used for single cell library construction
[0016] TSO 5′-AAGCAGTGGTATCAACGCAGAGTACATrGrG+G-3′ Oligo-dT30VN 5′ – AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3′
[0017] The above synthesized primers were diluted to 100 μM with 1×TE Buffer (nuclease-free), and then aliqu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



