Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

pH-sensitive nucleic acid quantitative detection method and device

A nucleic acid quantification and detection method technology, which is applied in the field of pH-sensitive nucleic acid quantitative detection, can solve the problems of bulky, unsuitable for rapid detection, and expensive detection instruments, and achieves a wide application range, high detection sensitivity and accuracy, and easy operation Effect

Pending Publication Date: 2021-09-03
SHENZHEN GRADUATE SCHOOL TSINGHUA UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the method of fluorescence quantification requires an optical path device for excitation and detection of fluorescence, which makes the detection instrument expensive and cumbersome, and is not suitable for rapid on-site detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • pH-sensitive nucleic acid quantitative detection method and device
  • pH-sensitive nucleic acid quantitative detection method and device

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0060] A new coronavirus plasmid is used as a reference template and a sample to be tested. The plasmid sequence is as follows:

[0061] GAATTCATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pH-sensitive nucleic acid quantitative detection method and device. The method comprises the following steps: S1, performing a nucleic acid amplification reaction by using a plurality of reference templates, and detecting the real-time pH value of an amplification reaction solution; S2, obtaining an S-shaped curve of the pH value of each reference template along with time change in the amplification process, and determining the pH threshold value of the S-shaped curve of each reference template in the rapid amplification period; S3, establishing an initial concentration-time standard curve according to the initial concentration of each reference template and the time for reaching the pH threshold in the amplification process; S4, performing nucleic acid amplification reaction on a to-be-detected sample under the same condition as that in the S1, detecting the real-time pH value, and determining the time for reaching the pH threshold value, wherein the nucleic acid types and sequences of the to-be-detected sample and the reference template are the same; and S5, determining the initial concentration of the to-be-detected sample according to the initial concentration-time standard curve and the time determined in the step S4. According to the invention, the structure simplification and miniaturization of the detection device can be realized, the operation is convenient, and the detection sensitivity and accuracy are high.

Description

technical field [0001] The invention relates to the field of nucleic acid detection, in particular to a pH-sensitive nucleic acid quantitative detection method and device. Background technique [0002] Nucleic acid quantitative detection is a technology that amplifies nucleic acid and monitors the amplification process by different means to obtain the initial concentration of nucleic acid before amplification. Ordinary polymerase chain reaction (PCR) can only roughly detect the amount of amplified product after the reaction is over, the so-called endpoint method, which cannot be used for quantitative detection of nucleic acid in the sample. This is mainly because, as the reaction proceeds, primers and nucleotide starting materials are continuously consumed, and ultimately cannot be exponentially amplified. Therefore, in traditional PCR, there is no linear relationship between the final yield of amplified products and the initial copy number of the template. [0003] To rea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6851C12M1/38C12M1/36C12M1/34C12M1/00
CPCC12Q1/6851C12Q2545/114C12Q2527/119C12Q2565/607
Inventor 弥胜利徐菲陈百良黄嘉骏
Owner SHENZHEN GRADUATE SCHOOL TSINGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products