Primer and primer probe combination of fluorescent quantitative nanoparticle PCR for detecting novel coronavirus and application of primer and primer probe combination

A primer-probe and nanoparticle technology, applied in the field of detection, can solve problems such as limiting the application of nano-PCR, and achieve the effect of improving specificity

Pending Publication Date: 2021-09-07
THE GBA NAT INST FOR NANOTECHNOLOGY INNOVATION
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the application of nano-PCR in real-time fluorescence quantification is limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and primer probe combination of fluorescent quantitative nanoparticle PCR for detecting novel coronavirus and application of primer and primer probe combination
  • Primer and primer probe combination of fluorescent quantitative nanoparticle PCR for detecting novel coronavirus and application of primer and primer probe combination
  • Primer and primer probe combination of fluorescent quantitative nanoparticle PCR for detecting novel coronavirus and application of primer and primer probe combination

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1 A kind of fluorescent quantitative nanoparticle PCR instrument

[0054] This nanoparticle PCR instrument contains a laser heating device, the laser heating device such as figure 1 As shown, it includes: a constant temperature bath assembly and a laser light source assembly. The constant temperature bath assembly provides heat for the annealing and extension steps in the cycle process in the PCR reaction, the temperature of the constant temperature bath is the temperature of annealing / extension in the PCR reaction, and the laser light source irradiates the nanoparticles to realize the micro-particles around the nanoparticles. The environment heats up rapidly, thus providing the thermal denaturation temperature in the PCR reaction. The laser irradiation time of this laser heating module can be adjusted between 0.1ms and 5s according to the experimental requirements.

[0055] The nanoparticle PCR instrument also includes a multi-channel fluorescence acquisiti...

Embodiment 2

[0056] Embodiment 2 A kind of nanoparticle of nanoparticle PCR reaction

[0057] Nanoparticles are semiconductor nanomaterials with excitation wavelengths or emission wavelengths other than 490nm to 700nm. In this embodiment, silver nanoparticles with an excitation wavelength of 390nm are selected, and the diameter of the nanoparticles is 10nm. Gold nanoparticles with a diameter of 10nm are used as control.

[0058] Use the ultraviolet-visible spectrophotometer to carry out the test of ultraviolet-visible absorption spectrum, see specifically figure 2 with image 3 , the results show that the absorption wavelength of the silver nanoparticles is outside the action wavelength of the fluorophore, which is 490nm to 700nm (the excitation wavelength range of the fluorophore is between 490nm and 600nm, and the emission wavelength range is between 500nm and 700nm), indicating that the The nano-silver particles with a diameter of 10 nm will not interfere with the excitation and emis...

Embodiment 3

[0060] Example 3 Establishment of a Fluorescent Quantitative Nanoparticle PCR Method for Detecting Novel Coronavirus 2019-nCoV

[0061] 1. Design of primers and probes

[0062] Through sequence comparison and using the professional software primer primer5, specific primers and probes for the detection of new coronavirus nucleic acids were designed, and primers and probes were synthesized. The specific sequences are as follows:

[0063] ORF1ab gene upstream primer F1 sequence: CGGAAGCCAATATGGATCAAG (SEQ ID NO: 1),

[0064] ORF1ab gene downstream primer sequence R1 column: TTGGATGATCTATGTGGCAACG (SEQ ID NO: 2),

[0065] ORF1ab gene probe P1 sequence: FAM-CTTTGGTGGTGCATCGTGTTGTCTG-BHQ1 (SEQ ID NO: 7),

[0066] N gene upstream primer F2 sequence: CATACAATGTAACACAAGCTTTCGG (SEQ ID NO: 3),

[0067] N gene downstream primer R2 sequence: TTCCTTGTCTGATTAGTTCCTGGTC (SEQ ID NO: 4),

[0068] N gene probe P2 sequence: ROX-ACGTGGTCCAGAAACAAACCCAAGGA-BHQ2 (SEQ ID NO: 8),

[0069] Intern...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
wavelengthaaaaaaaaaa
diameteraaaaaaaaaa
Login to view more

Abstract

The invention discloses a primer and a primer probe combination of fluorescent quantitative nanoparticle PCR for detecting novel coronavirus and application of the primer and the primer probe combination. The 5' end of the primer is modified with nanoparticles, and the nanoparticles are conductor or semiconductor nanoparticles. The invention further provides the primer probe combination containing the primer and a kit, and provides a non-diagnostic purpose detection method of the novel coronavirus 2019-nCoV. The primer probe combination is used, a PCR instrument containing a laser heating device is used for detection, the primer with the surface modified with silver nanoparticles is used, rapid temperature rising and lowering are conducted through specific wavelength laser heating, the qPCR amplification time can be shortened to be within 30min, and fluorescent quantitative PCR needs 60-120min; and the detection sensitivity of the primer is as low as 1copy and is improved by 10 times compared with fluorescent quantitative PCR, fluorescent quantitative nanoparticle PCR can inhibit non-specific amplification of virus SARS with high homology with the novel coronavirus, and the specificity of the system is improved.

Description

technical field [0001] The present invention relates to the technical field of detection, in particular to a primer for fluorescent quantitative nanoparticle PCR for detecting novel coronavirus, a primer-probe combination and its application. Background technique [0002] Coronavirus is a large family of viruses. Novel coronavirus pneumonia (COVID-19) is a new acute respiratory infectious disease in 2019, and a new strain of coronavirus that has never been found in humans before. People infected with this virus will have symptoms of varying degrees, some are just fever or mild cough, some will develop pneumonia, and some will be more serious or even die. Most of the fatal cases are closely related to their comorbidities, and the higher the age, the higher the fatality rate of the disease, and the fatality rate of male patients is higher than that of female patients. [0003] According to the "Diagnosis and Treatment Plan for Novel Coronavirus Pneumonia", a positive real-tim...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11
CPCC12Q1/701C12Q1/6851C12Q2600/16C12Q2600/166C12Q2531/113C12Q2537/143C12Q2563/107C12Q2563/137C12Q2563/149C12Q2545/113C12Q2521/107C12Q2523/319Y02A50/30
Inventor 肖彩霞袁巧梅王涛
Owner THE GBA NAT INST FOR NANOTECHNOLOGY INNOVATION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap