Mycoplasma pneumoniae rapid detection primer group and kit
A technology of mycoplasma pneumoniae and detection kits, which is applied in the direction of microorganisms, microorganisms, recombinant DNA technology, etc., can solve the problems of high cost experimental design, high possibility of pollution, high operation requirements, etc., and achieve simple detection and nucleic acid amplification  Short time, reduce the effect of background fluorescence
- Summary
 - Abstract
 - Description
 - Claims
 - Application Information
 
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1, Screening of Mycoplasma pneumoniae rapid detection primer set
[0069] Download the conserved sequence of Mycoplasma pneumoniae P1 gene (serial number CP002077.1) from Genebank, design 4 pairs of primers (Table 1) by PrimerPremier 6 software, use EMA universal enzyme, cross-pair the primers, a total of 16 combinations, and amplify separately A plasmid containing the P1 gene sequence. 10-fold serial dilution of the plasmid, the concentration is 1×10 6 copies / μl, 1×105 copies / μl, 1×10 4 copies / μl, 1×103 copies / μl, 1×10 2 Copies / μl, 10c / μl, 1copies / μl, and set a negative control, electrophoresis detection after amplification.
[0070] Table 1 Primer list
[0071] sequence name
sequence
1F
CGTATCGTAACACGAGCTTTTCCTCCC
1R
GCCCGGTTTGGTCGCGCGTGGGCGTTTGCG
2F
GGCCTTAGTGCGCGACAACAGCGCTAAG
2R
AAAGCCGCCAAAGGGGTTAAAGGTGATCTG
3F
GGCAGTCAACAAACCACGTATGATCCC
3R
GACCTCGTTTCACTGTTGGGGTGCAGC
4F
...
Embodiment 2
[0074] Embodiment 2, primary screening of Mycoplasma pneumoniae rapid detection probe
[0075] The sequences of the two public probes designed according to the results of Example 1 are shown in Table 2. The 3 pairs of primers screened in Example 1 were cross-combined with 2 pairs of probes to form 6 combinations. Each combination cooperates with EMA universal enzyme, amplifies the plasmid containing the P1 gene sequence as a template, and the concentration is 1×10 4 copies / μl.
[0076] Table 2 Probe sequence
[0077]
[0078] Probe preliminary screening criteria: the positive fluorescence curve is a typical "S" shape, and the Ct value is the smallest, and the negative fluorescence curve is a horizontal straight line.
[0079] See the results of the preliminary screening of the probe figure 2 . Among them, the 2F / 2R-P2 amplification curve is not a typical "S" type, so it is excluded; line ① is negative for 3F / 4R-P1 amplification, and the negative has an amplification cu...
Embodiment 3
[0084] Embodiment 3, preparation Mycoplasma pneumoniae rapid detection kit
[0085] In this example, the primer set obtained by screening in Example 2 was used. Based on the EMA technology, the lysate, complex solution, and EMA reaction tubes containing primers and probes were designed respectively.
[0086] (1) lysate
[0087] By comparing the collocation, ratio, lysis effect and lysis time of each extraction reagent, the finally selected lysate contains 2-5% NP-40 (v / v), 20-50mg / mL chelex-100, 10 - 20 mM Tris-Ac pH 8.0 and ultrapure water.
[0088] (2) Complex solution and EMA reaction tube containing primer probe
[0089] By repeatedly adjusting the content of primers and probes, and verifying the amplification effect of the reaction system, the best amplification system was formed:
[0090] The selected complex solution contains MgAc2 at a final concentration of 20-30mM, Tris-Ac (pH8.0) at 90-100mM, KAc at 55-60mM, PEG20000 (W / V) at 10-15% and ultrapure water.
[0091...
PUM
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More - R&D
 - Intellectual Property
 - Life Sciences
 - Materials
 - Tech Scout
 
- Unparalleled Data Quality
 - Higher Quality Content
 - 60% Fewer Hallucinations
 
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



