Primer, reagent kit and method for detecting clostridium difficile

A Clostridium difficile and kit technology, applied in the field of molecular biology, can solve problems such as complex application, difficult sequence feature analysis, complex target sequence preparation, etc., to achieve the effect of avoiding sample cross-contamination and simplifying the operation process

Active Publication Date: 2019-12-31
湖南融健生物科技有限公司
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

LAMP products are complex, and it is difficult to carry out further sequence characteristics and other related analysis on the products, resulting in complicated subsequent applications, and it is not easy to further carry out simultaneous analysis of multiple sequences
RCA relies on circular templates, but the vast majority of genomic DNA is linear molecules, and the cost of synthesizing rolling circle amplification lock probes is high, and there is a signal background problem. The generation of target DNA fragments containing enzyme cleavage sites at both ends and multiple stages of strand displacement reaction require modified dNTPs as substrates, and the preparation of target sequences is complex

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, reagent kit and method for detecting clostridium difficile
  • Primer, reagent kit and method for detecting clostridium difficile
  • Primer, reagent kit and method for detecting clostridium difficile

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Amplification and detection of Clostridium difficile toxin B gene tcdB

[0048] Use the tcdB plasmid DNA containing the toxin B gene as the detection target for screening the dominant primers.

[0049] Wherein, the conserved sequence of the toxin gene tcdB of Clostridium difficile is shown in SEQ ID NO:13.

[0050] SEQ ID NO: 13

[0051] TCTATTTCTGATGCACTATGTGACTTAAAACAACAGAATGAATTAGAAGATTCTCATTTTATATCTTTTGAGGACATATCAGAGACTGATGAGGGGTTTAGTATAAGATTTATTAATAAAGAAACTGGAGAATCTATATTTGTAGAAACTGAAAAAACAATATTCTCTGAATATGCTAATCATATAACTGAAGAGATTTCTAAGATAAAAGGTACTATATTTGATACTGTAAATGGTAAGTTAGTAAAAAAAGTAAATTTAGATACTACACACGAAGTAAATACTTTAAATGCTGCATTTTTTATACAATCATTAATAGAATATAATAGTTCTAAAGAATCTCTTAGTAATTTAAGTGTAGCAATGAAAGTTCAAGTTTACGCTCAATTATTTAGTACTGGTTTAAATACTATTACAGATGCAGCCAGAGTTGTTGAATTAGTATCAACTGCATTAGATGAAACTATAGACTTACTTCCTACATTATCTGAAGGATTACCTATAATTGCAACTATTATAGATGGTGTAAGTTTAGGTGCAGCAATCAAAGAGCTAAGTGAAACGAGTGACCCATTATTAAGACAAGAAATAGAAGCTAAGATAGGTATAATGGCAGTAAATTTAACAACAGC...

Embodiment 2

[0066] The reaction efficiency verification of embodiment 2 different primers

[0067] Preparation of an isothermal amplification reaction mixture, wherein the reaction mixture contains Mg 2+ The concentration is 8mM; K + The concentration is 6mM; NH 4 + The concentration is 10mM; H + The concentration is 20mM; Cl - The concentration is 6mM; SO 4 2- The concentration of Tris-HCl is 10mM; the concentration of Tris-HCl is 20mM; the concentration of Triton X-100 is 0.01g / mL; the concentration of dNTP is 1.4mM; the concentration of thymine DNA glycosylase is 50U / mL; The concentration is 320U / mL; the primers shown in P1 in Table 1 are 0.2 μM, the primers shown in P2 are 0.8 μM, the primers shown in P3 are 0.2 μM, and the primers shown in P4 are 0.8 μM, and SYBR Green I is a real-time fluorescence analysis dye . Use 3 sets of primer mixtures with 3 sets of primers configured after design, screening and comparison, use tcdB plasmid DNA at a concentration of 10 fM as the det...

Embodiment 3

[0068] Example 3 Reaction Sensitivity Verification

[0069] As described in Example 2, the amplification detection mixture and the primer mixture configured by the third set of primers were amplified and real-time fluorescently detected under the conditions of 63°C and 90min for real-time fluorescence curves of different concentrations of tcdB plasmid DNA, each concentration in turn It is 10 pM, 1 pM, 100 fM, 10 fM, 1 fM, 100 aM, 0 aM. Use a real-time fluorescent quantitative PCR instrument for detection, and read the fluorescence value every 30s. For the real-time fluorescence curve of the specific results, please refer to the attached image 3 . The real-time fluorescence curve shows that the concentration of tcdB plasmid DNA can be detected as low as 100aM in this example, indicating the high sensitivity and extremely low detection limit of the method of the present invention.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention provides a primer composition for detecting clostridium difficile. The primer composition is designed based on a conserved sequence of a toxin gene tcdB of the clostridium difficile. Theinvention further provides a reagent kit for detecting the clostridium difficile, and the reagent kit comprises the primer composition, enzymes for identifying and excising an unconventional DNA basein a strand in double-strand DNA, and DNA polymerase having the function of strand displacement. The invention further provides a method for detecting the clostridium difficile. According to the method provided by the invention, target sequences can be correctly detected, the specificity is good, and the detection sensitivity and the detection efficiency are greatly improved.

Description

technical field [0001] The invention belongs to the field of molecular biology and relates to a primer composition for detecting Clostridium difficile, and also relates to a kit and a method for detecting Clostridium difficile. Background technique [0002] Clostridium difficile (C.difficile) is a toxin-producing or non-toxin-producing anaerobic bacillus and is one of the normal flora of the human intestinal tract. When the normal intestinal flora is imbalanced due to the extensive use of broad-spectrum antibiotics and other reasons, the excessive reproduction of the bacteria will cause antibiotic-associated diarrhea, Clostridium difficile-associated diarrhea, etc., and in severe cases, it can cause pseudomembranous enteritis and even death. Clinically, about 15% to 25% of antibiotic-associated diarrhea, 50% to 75% of antibiotic-associated colitis and 95% to 100% of pseudomembranous colitis are caused by CDI (Clostridium difficile infection). In the United States and Europe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/04C12N15/11C12R1/145
CPCC12Q1/689C12Q1/6844C12Q2521/301C12Q2521/531C12Q2561/113C12Q2563/107
Inventor蒋健晖王海波唐丽娟
Owner湖南融健生物科技有限公司