Medicine for treating ketamine addiction
A technology of ketamine and drugs, applied in the field of anti-addiction drugs, can solve the problems of lack of drugs for treating addiction, easy addiction of ketamine, no Mgll and ketamine addiction, etc., achieve good industrial prospects and public value, reduce Effects of Ketamine Addiction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
experiment example 1
[0030] Experimental Example 1 Construction of AAV-Mg11 (adeno-associated virus overexpressing Mg11) of the present invention
[0031] 1. Preparation of recombinant vector
[0032] (1) Carrier information:
[0033] Plasmid name: H7286
[0034] Gene name: Mgll, monoacylglycerol lipase
[0035] Gene species: Mus musculus
[0036] Gene length: 912bp
[0037] Basic scheme: annealing, enzyme digestion and ligation
[0038] (2) Materials and methods
[0039] 1. Instruments and equipment
[0040]
[0041] 2. Experimental reagents
[0042]
[0043] 3. Experimental method
[0044] (1) Design and synthesize the overexpression sequence (SEQ ID NO.1) according to the target gene Mg11 as follows:
[0045] atgcctgaggcaagttcacccaggcgaactccacagaatgttccctaccaggacctgcctcacctggtcaatgcagacggacagtacctcttttgtagatactggaagcccagtggcacacccaaggccctcatctttgtgtcccatggagctggggaacactgtggccgttatgatgagctggctcatatgttgaaggggctggacatgctggtatttgcccatgaccatgttggccatgggcagagtgagggagagaggatggtggtgtcgga...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com