Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant bacillus subtilis natto with high yield of vitamin K2 as well as preparation method and application

A technology of Bacillus subtilis and Natto subtilis, which is applied in the field of genetic engineering, can solve the problems of low vitamin K2 synthetic metabolic flow and complex metabolic pathways, and achieve the effects of weakening metabolic pathways, enhancing metabolic flow, and increasing production

Pending Publication Date: 2021-12-24
INNER MONGOLIA KINGDOMWAY PHARMA +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the complex metabolic pathway for the synthesis of MK-7, which involves multiple pathways such as the glycolytic pathway, the pentose phosphate pathway, the mevalonate pathway, and the menadione pathway, the anabolic flux of vitamin K2 is low , the menadione content in wild strains is generally maintained at a very low level

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus subtilis natto with high yield of vitamin K2 as well as preparation method and application
  • Recombinant bacillus subtilis natto with high yield of vitamin K2 as well as preparation method and application
  • Recombinant bacillus subtilis natto with high yield of vitamin K2 as well as preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1. Construction of the signal peptide response mechanism screening circuit

[0035] The gene company synthesized the PtrpSP fragment, and its nucleotide sequence is as follows:

[0036] CCGCGCTTACGAAGCCGCATTCTGACTGTCAGATGCGGCTTCGCTTCATTGTTACCACTCCTGTTATTCCTCAACCCTTTTTTTAA ACATTAAAATTCTTACGTAATTTATAATCTTTAAAAAAAGCATTTAATATTGCTCCCCGAACGATTGTGATTCGATTCACATTTAAACAA TTTCAGAATAGACAAAAACTCTGAGTGTAATAATGTAGCCTCGTGTCTTGCGAGGATAAGTGCATTATGAATATCTTACATATATGTGTG ACCTCAAAATGGTTCAATATTGACAACAAAATTGTCGATCACCGCCCTTGATTTGCCCTTCTGTAGCCATCACCAGAGCCAAACCGATTA GATTCAATGTGATCTATTTGTTTGCTATATCTTAATTTTGCCTTTTGCAAAGGTCATCTCTCGTTTATTTACTTGTTTTAGTAAATGATG GTGCTTGCATATATATCTGGCGAATTAATCGGTATAGCAGATGTAATATTCACAGGGATCACTGTAATTAAAATAAATGAAGGATTATGT AATGGAAAACTTTAAACATCTCCCTGAACCG。 SEQ ID NO:1

[0037] Restriction endonucleases SphI and BamHI were used to digest and ligate the fragment and the shuttle empty vector pAX01 plasmid respectively to obtain pAX01-PtrpSP.

[0038] Based on the Bacill...

Embodiment 2

[0054] Example 2. Construction of overexpression vector

[0055] Based on the genome of Bacillus subtilis subsp.natto BEST195 (GenBank:AP011541.2) (the 333805th to 334365th of its synthesis is the template for amplifying AroK; the 2167761st to 2168951st of its synthesis is the template for amplifying AroF template; synthesize its 3823548 to 3824432 as the template for amplifying MenA), and PCR amplify respectively to obtain chorismate synthase (AroF), shikimate kinase (AroK) and 1,4-dihydroxy-2 naphthoic acid Salt-octyltransferase (MenA) gene fragments (these fragments can also be synthesized directly).

[0056] Using primers AroF-IF\AroF-IR (SEQ ID NO:8 and SEQ ID NO:9), AroK-F\AroK-R (SEQ ID NO:10 and SEQ ID NO:11), MenA-F\MenA- R (SEQ ID NO:12 and SEQ ID NO:13), carry out PCR amplification, obtain chorismate synthetase (AroF) (shown in SEQ ID NO:14), shikimate kinase (AroK) (SEQ ID NO:15 shown) and 1,4-dihydroxy-2 naphthoate-octyltransferase (MenA) gene sequence (shown in...

Embodiment 3

[0095] Embodiment 3. Containing the Bacillus subtilis natto engineering strain construction of screening circuit and overexpression vector

[0096] ⑴ Preparation of Natto Bacillus subtilis Competent Cells

[0097] ①Pick a single colony of Bacillus subtilis natto (DSM 1088) that has been activated on the plate to 3mL LB medium, and cultivate overnight at 30°C on a shaker at 200r / min.

[0098] ②Take 2.5ml of the overnight culture and inoculate into 40ml (LB+0.5M sorbitol), culture at 30°C and 200rpm until OD600=0.85-0.95.

[0099] ③Bath the bacterial solution in ice water for 10min, then centrifuge at 5000g for 5min at 4°C to collect the bacterial cells.

[0100] ④Use 50ml pre-cooled electroporation medium (0.5M sorbitol, 0.5M mannitol, 10% glycerol), re-blow the suspended bacteria, centrifuge at 5000g, 5min, 4°C to remove the supernatant, and rinse 4 times like this.

[0101] ⑤ Resuspend the washed bacteria in 1ml of electroporation medium, aliquot into 1.5mL sterile centrifu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant bacillus subtilis natto with high yield of vitamin K2. A strain comprises a bacillus subtilis natto carrier and a nucleotide sequence for coding the following genes: tryptophan positive feedback activation signal peptide PtrpSP, toxic polypeptide txpA, cell wall peptide chain endonuclease cwlO, shikimic acid kinase AroK, chorismate synthetase AroF and 1,4-dihydroxy-2-naphthoate-octyl transferase MenA. The recombinant bacillus subtilis natto takes natto bacillus subtilis as a receptor strain, the yield of MK-7 in recombinant bacteria is increased by regulating and controlling a plurality of key enzymes in an MK-7 synthesis route, the yield is increased by 125% when fermentation is carried out for 96 hours compared with that of a wild strain MK-7, and fermentation production of the vitamin K2 has a huge industrial application prospect.

Description

technical field [0001] The invention relates to genetic engineering technology, in particular to a recombinant bacillus subtilis natto with high yield of vitamin K2, its preparation method and application. Background technique [0002] Vitamin K2, also known as menadione, is an essential fat-soluble vitamin. It has many different isomers, which are represented by MK-n according to the number of isoprene units at the C3 position in its molecular structure Among them, MK-7 has the highest biological activity and the longest half-life. Vitamin K2 can regulate the synthesis of various coagulation factors by promoting the synthesis of prothrombin in the liver, and is also a necessary cofactor for the carboxylation of osteocalcin, which plays an important role in bone development and helps to transfer calcium ions to bones , which plays a key role in blood coagulation and prevention of osteoporosis, is considered to be the fourth generation anti-osteoporosis drug. In addition, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/75C12N15/54C12N15/57C12N15/60C12N15/31C12P7/66C12R1/125
CPCC12N15/75C12Y207/01071C12N9/1205C12N9/1029C12Y402/03005C12N9/88C12N9/50C07K14/32C12P7/66C12N15/52
Inventor 詹光煌卢英华钟锦潮陈必钦段然陈婷婷严必能李丹
Owner INNER MONGOLIA KINGDOMWAY PHARMA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More