Method for promoting cell-catalyzed allitol production by utilizing recombinant intracellular-RNA-support-immobilized recombinase
A technology for catalyzing allolol and fixing stents, which is applied in the field of biochemical industry
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Construction of Escherichia coli Engineering Bacteria Using Triangular Mesh RNA Scaffold to Immobilize Recombinase to Catalyze Alolol
[0041] 1. Construction of RNA scaffold recombinant plasmid
[0042] 1) Entrust the company to synthesize a DNA sequence as shown in SEQ ID No.6;
[0043] 2) Using primer 1 and primer 2 to linearize the pET22b plasmid;
[0044] Primer 1: 5'>CCCTATAGTGAGTCGTATT AACCTAATGCAGGTCCCGGAAGA <3', the underlined sequence is the overlapping sequence with the pET22b plasmid.
[0045] Primer 2: 5'>CCAATGGCGCGCCGAGCTTGGCGTAAT gctcgccacttcgggctcatgagcg <3', the underlined sequence is the overlapping sequence with the pET22b plasmid.
[0046] reaction system:
[0047]
[0048] Reaction conditions:
[0049] PCR amplification reaction conditions
[0050]
[0051]
[0052] 3) Gel cutting recovery for purifying the linearized pET22b plasmid:
[0053] a) Cut off the strips to be recovered from the electrophoresis gel under ultrav...
Embodiment 2
[0151] Embodiment 2 verifies the expression of recombinant ribitol dehydrogenase and formate dehydrogenase in Escherichia coli engineering bacteria
[0152]Inoculate the single colony of the selected E. coli engineering strain into the medium as the seed solution. The medium contains 1% tryptone, 0.5% yeast extract, 1% NaCl, chloramphenicol and ampicillin to a final concentration of 100 μg / mL of LB medium. Use a 50ml flask containing 10ml medium to incubate at 37°C and 200rpm for 12h.
[0153] A 500 mL flask was used for culturing, and the flask was filled with 100 mL of a culture medium added with chloramphenicol and ampicillin to a final concentration of 100 μg / mL, and the inoculum size was 1 ml. The formula of the medium is 1% tryptone, 0.5% yeast extract, 1% NaCl, 0.5% glucose, 20mM MgCl 2 . The cultivation was initially started at 37°C and 200 rpm. After culturing for 3 hours, when the OD of the culture solution was 0.6-0.8, IPTG was added to a final concentration of...
Embodiment 3
[0162] Example 3 Verification of the production of allolol by fermentation of Escherichia coli engineering bacteria I using triangular network RNA scaffolds to immobilize recombinant enzymes to catalyze allolol in the present invention
[0163] The medium for seed culture or cell preparation for molecular experiments is LB medium containing 1% tryptone, 0.5% yeast extract, 1% NaCl supplemented with chloramphenicol and ampicillin to a final concentration of 100 μg / mL . Use a 50 ml flask containing 10 ml medium to incubate at 37° C. and 200 rpm for 12 hours to obtain activated Escherichia coli engineering strain I strain.
[0164] A 500 mL flask was used for culturing, and the flask was filled with 100 mL of a culture medium added with chloramphenicol and ampicillin to a final concentration of 100 μg / mL, and the inoculum size was 1 ml. The formula of the medium is 1% tryptone, 0.5% yeast extract, 1% NaCl, 0.5% glucose, 20mM MgCl 2 . The cultivation was initially started at 37...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com