Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Method for promoting cell-catalyzed allitol production by utilizing recombinant intracellular-RNA-support-immobilized recombinase

A technology for catalyzing allolol and fixing stents, which is applied in the field of biochemical industry

Active Publication Date: 2020-07-07
SHANDONG UNIV +1
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Retrieval shows that there is no report on the method of using recombinant intracellular RNA scaffolds to immobilize recombinant enzymes to promote the production of allol (allitol) in cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for promoting cell-catalyzed allitol production by utilizing recombinant intracellular-RNA-support-immobilized recombinase
  • Method for promoting cell-catalyzed allitol production by utilizing recombinant intracellular-RNA-support-immobilized recombinase
  • Method for promoting cell-catalyzed allitol production by utilizing recombinant intracellular-RNA-support-immobilized recombinase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Construction of Escherichia coli Engineering Bacteria Using Triangular Mesh RNA Scaffold to Immobilize Recombinase to Catalyze Alolol

[0041] 1. Construction of RNA scaffold recombinant plasmid

[0042] 1) Entrust the company to synthesize a DNA sequence as shown in SEQ ID No.6;

[0043] 2) Using primer 1 and primer 2 to linearize the pET22b plasmid;

[0044] Primer 1: 5'>CCCTATAGTGAGTCGTATT AACCTAATGCAGGTCCCGGAAGA <3', the underlined sequence is the overlapping sequence with the pET22b plasmid.

[0045] Primer 2: 5'>CCAATGGCGCGCCGAGCTTGGCGTAAT gctcgccacttcgggctcatgagcg <3', the underlined sequence is the overlapping sequence with the pET22b plasmid.

[0046] reaction system:

[0047]

[0048] Reaction conditions:

[0049] PCR amplification reaction conditions

[0050]

[0051]

[0052] 3) Gel cutting recovery for purifying the linearized pET22b plasmid:

[0053] a) Cut off the strips to be recovered from the electrophoresis gel under ultrav...

Embodiment 2

[0151] Embodiment 2 verifies the expression of recombinant ribitol dehydrogenase and formate dehydrogenase in Escherichia coli engineering bacteria

[0152]Inoculate the single colony of the selected E. coli engineering strain into the medium as the seed solution. The medium contains 1% tryptone, 0.5% yeast extract, 1% NaCl, chloramphenicol and ampicillin to a final concentration of 100 μg / mL of LB medium. Use a 50ml flask containing 10ml medium to incubate at 37°C and 200rpm for 12h.

[0153] A 500 mL flask was used for culturing, and the flask was filled with 100 mL of a culture medium added with chloramphenicol and ampicillin to a final concentration of 100 μg / mL, and the inoculum size was 1 ml. The formula of the medium is 1% tryptone, 0.5% yeast extract, 1% NaCl, 0.5% glucose, 20mM MgCl 2 . The cultivation was initially started at 37°C and 200 rpm. After culturing for 3 hours, when the OD of the culture solution was 0.6-0.8, IPTG was added to a final concentration of...

Embodiment 3

[0162] Example 3 Verification of the production of allolol by fermentation of Escherichia coli engineering bacteria I using triangular network RNA scaffolds to immobilize recombinant enzymes to catalyze allolol in the present invention

[0163] The medium for seed culture or cell preparation for molecular experiments is LB medium containing 1% tryptone, 0.5% yeast extract, 1% NaCl supplemented with chloramphenicol and ampicillin to a final concentration of 100 μg / mL . Use a 50 ml flask containing 10 ml medium to incubate at 37° C. and 200 rpm for 12 hours to obtain activated Escherichia coli engineering strain I strain.

[0164] A 500 mL flask was used for culturing, and the flask was filled with 100 mL of a culture medium added with chloramphenicol and ampicillin to a final concentration of 100 μg / mL, and the inoculum size was 1 ml. The formula of the medium is 1% tryptone, 0.5% yeast extract, 1% NaCl, 0.5% glucose, 20mM MgCl 2 . The cultivation was initially started at 37...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for promoting cell-catalyzed allitol production by utilizing recombinant intracellular-RNA-support-immobilized recombinase. The method comprises the steps: (1) constructing a triangular reticular RNA support for immobilizing an intracellular recombinant protein; (2) constructing recombinant plasmids for anchoring ribitol dehydrogenase and formate dehydrogenase in the triangular reticular RNA support; (3) constructing Escherichia coli engineering strains employing the triangular reticular RNA support immobilized recombinase to catalyze allitol; and (4) conducting fermentation by using the Escherichia coli engineering strains constructed in the step (3) to produce the allitol. According to the method, the ribitol dehydrogenase and the formate dehydrogenase are anchored by using the RNA support, the distance of an enzymatic reaction is shortened, and the synthesis of the allitol is efficiently promoted. Proven by experiments, the allitol yield of the engineering strains constructed by the method disclosed by the invention can be increased to 4.433g / L from 3.036g / L, so that the yield of the product is advantageously maximized in industrial practical applications.

Description

technical field [0001] The invention relates to a method for using a recombinant intracellular RNA scaffold to immobilize a recombinase to promote the production of allol (allitol) catalyzed by cells. It belongs to the field of biochemical industry. Background technique [0002] Allol (allicitol) is a rare six-carbon sugar alcohol that can be used as a non-energy sweetener or bulking agent in the food industry. It is a pharmaceutical intermediate for the treatment of diabetes, cancer and AIDS, and is also used for the treatment of constipation. medicine. It can also be used as a substrate to produce other types of D or L-type rare sugars, such as D / L-arabinose and D / L-allose. [0003] Allol alcohol is found in very low levels in nature. Therefore, extraction from natural sources is not economical and can wreak havoc on the environment. The chemical synthesis of allol alcohol is complicated, the yield is low, and toxic by-products will be produced. In contrast, biotransf...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/70C12P19/02C12R1/19
CPCC12P19/02C12N9/0006C12N9/0008C12Y101/01056C12N15/70Y02E50/10
Inventor 林建强柴玉颖温鑫任一林孙煦茵宋欣林建群
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com