Specific sequence for sex determination of snakehead and application

A technology of sex and snakehead, which is applied in the specific sequence and application field of the sex identification of snakehead, can solve the problems of insufficient conservation, low accuracy of gender identification markers, unclear X and Y chromosome conservative sequences, etc., and achieve fish body Less damage, reduced analysis data volume, quality and efficiency improvement effects

Active Publication Date: 2022-01-14
INST OF AQUATIC LIFE ACAD SINICA +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The genome sequence of the female snakehead has been released so far, without the Y chromosome, and the conserved sequence between the X and Y chromosomes is unclear, so there are cases where the accuracy of sex identification markers is not high
For example, the published application "Male Molecular Marker Primers and Applications of Channa sinensis" has application number CN201611247108.6. In practical applications, it was found that the marker would judge a small number of male individuals as female individuals, indicating that the molecular marker region will still be in the Exchange occurs between X and Y chromosomes, the conservation type is not high enough

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific sequence for sex determination of snakehead and application
  • Specific sequence for sex determination of snakehead and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Acquisition of Indel markers for sex identification of snakehead:

[0027] 1) Select 16 females and 16 males in different waters with sex determined, and perform whole-genome sequencing, and the data volume obtained is about 30G / tail. Select one female and one male sequencing data respectively, and carry out 60bp electronic enzyme digestion treatment starting from six bases of AC, AG, AT, GA, GC and GT. The frequency of various restriction enzyme fragments was obtained after removing redundancy. According to the frequency distribution, the enzyme-cut fragments within the frequency range of the single-copy site were determined and compared to obtain the consensus fragment (A) and the sex-specific fragment (B).

[0028] 2) Consensus fragment (A) was assembled using Velvet software to obtain A-contig. Take A-contig as reference, A and B as query, and use Boutai2 software to compare the default values. In the output result, allelic fragments are obtained by pairing accor...

Embodiment 2

[0034] The application process of the sequence shown in SEQ ID NO.3 in the sex identification of snakehead:

[0035] 1) Design primers for the nucleotide sequence comprising the sequence shown in SEQ ID NO.3:

[0036] CAYSPE-F:GTGTCAATTGTGAGTCCTTGATG

[0037]CAYSPE-R:CCATGCTCTGATCAGTAAATACAC

[0038] 2) Genomic DNA extraction:

[0039] Add 150 μl of 5% chelex100 to a 96-well plate equipped with caudal fins, digest at 58°C for 1 hour, boil at 100°C for 8 minutes, centrifuge at 4000 rpm for 5 minutes, and take 1 μl of the supernatant as a PCR reaction template.

[0040] 3) PCR amplification:

[0041] Configure the reaction system in a 96-well plate, the reaction system is 10×Buffer (Mg 2+ plus) 1μl; LC Green 1μl; dNTP (10mM each) 0.2uL; CAYSPE-F (10mM) 0.2uL; CAYSPE-R (10mM) 0.2uL; Taq (5U / uL) 0.1uL; template DNA 1μl, and finally add ddH 2 0 to 10 μl. The PCR reaction conditions were pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 55°C for 3...

Embodiment 3

[0053] The application process of the sequence shown in SEQ ID NO.2 in the sex identification of snakehead:

[0054] 1) Collect 36 male and female snakeheads of known gender, and 12 extra males. Collect fin ray tissue samples and store them in a 96-well plate for cryopreservation. Genomic DNA is extracted by chelex100 boiling method.

[0055] 2) Utilize the method in Example 2 to carry out PCR amplification on the above-mentioned snakehead DNA sample.

[0056] 3) PCR amplification products were subjected to HRM typing.

[0057] 4) The HRM typing results show that the identification results using the Indel markers provided by the present invention are completely consistent with the known results, and the identification accuracy rate reaches 100%.

[0058] 5) Test results such as figure 2 shown.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of fish sex identification in the field of aquaculture, and discloses an Indel marker for snakehead sex identification and application, a snakehead sex specific marker is developed through whole genome sequencing and a biological information analysis process, aiming at the specific sequence, XX, XY and YY sex identification can be carried out on snakehead by utilizing an HRM detection technology, and through verification, the accuracy rate reaches 100%. Compared with previous dissection detection or reproductive process observation, the technology has the advantages of being accurate, simple, rapid, small in damage to fish bodies and the like, and can provide help for sex marking exploration of other fishes, sex control breeding of channa maculata and development of the all-male channa maculata culture industry.

Description

technical field [0001] The invention belongs to the field of sex identification of fish in the field of aquaculture, and in particular relates to a specific sequence for sex identification of snakehead snakeheads and its application. Background technique [0002] Channa argus (Channa argus) is mainly distributed in the Yangtze River and the water systems north of the Yangtze River, and belongs to Perciformes, Channaidae, and Channa genus. The snakehead is a medium-to-large size among freshwater economic fishes, and it is a ferocious carnivorous fish. In the farming practice of Channaidae fishes, it was found that the F1 generation of the snakehead as the female parent and the black snakehead, that is, the spotted snakehead, combined the advantages of the parents and had obvious hybrid vigor, growth speed, feeding performance, disease resistance and Compared with the parents, both parents have been greatly improved. The researchers found that the growth speed of the F1 male ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6888C12Q1/6879C12N15/11
CPCC12Q1/6888C12Q1/6879C12Q2600/156Y02A40/81
Inventor黄容欧密汪亚平陈昆慈杨诚赵建李勇明廖兰杰
OwnerINST OF AQUATIC LIFE ACAD SINICA