Nucleoside derivative modified aptamer R50
A technology of cytosine nucleoside derivatives and nucleic acid aptamers, applied in the fields of biotechnology and genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] The sequence of the 5-FU-modified nucleic acid aptamer obtained in this example is as follows, and its structure is as follows figure 2 shown, called F1,
[0059] 5'-(5-FU)T(5-FU)T(5-FU)TAAAGGGCGGGGGGTGGGGTGGTTGGTAGTTGTTTTTTCTG(5-FU)T(5-FU)C(5-FU)-3'.
Embodiment 2
[0061] The sequence of the 5-FU-modified nucleic acid aptamer in this example is as follows, and its structure is as follows image 3 shown, called F2,
[0062] 5'-TAAAGGGCGGGGGGTGGGGTGGTTGGTAGTTGTTTTTTCTG(5-FU)T(5-FU)C(5-FU)-3'.
Embodiment 3
[0064] The sequence of the 5-FU-modified nucleic acid aptamer in this example is as follows, and its structure is as follows Figure 4 shown, called F3,
[0065] 5'-(5-FU)T(5-FU)T(5-FU)TAAAGGGCGGGGGGTGGGGTGGTTGGTAGTTGTTTTTTCTGTTTC-3'.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



