Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nucleoside derivative modified aptamer R50

A technology of cytosine nucleoside derivatives and nucleic acid aptamers, applied in the fields of biotechnology and genetic engineering

Pending Publication Date: 2022-06-03
RENJI HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF14 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, many nucleic acid aptamers are already in the clinical research stage, but currently there is only one nucleic acid aptamer that targets VEGF and is used for age-related macular degeneration approved by the FDA[4]

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleoside derivative modified aptamer R50
  • Nucleoside derivative modified aptamer R50
  • Nucleoside derivative modified aptamer R50

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] The sequence of the 5-FU-modified nucleic acid aptamer obtained in this example is as follows, and its structure is as follows figure 2 shown, called F1,

[0059] 5'-(5-FU)T(5-FU)T(5-FU)TAAAGGGCGGGGGGTGGGGTGGTTGGTAGTTGTTTTTTCTG(5-FU)T(5-FU)C(5-FU)-3'.

Embodiment 2

[0061] The sequence of the 5-FU-modified nucleic acid aptamer in this example is as follows, and its structure is as follows image 3 shown, called F2,

[0062] 5'-TAAAGGGCGGGGGGTGGGGTGGTTGGTAGTTGTTTTTTCTG(5-FU)T(5-FU)C(5-FU)-3'.

Embodiment 3

[0064] The sequence of the 5-FU-modified nucleic acid aptamer in this example is as follows, and its structure is as follows Figure 4 shown, called F3,

[0065] 5'-(5-FU)T(5-FU)T(5-FU)TAAAGGGCGGGGGGTGGGGTGGTTGGTAGTTGTTTTTTCTGTTTC-3'.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a nucleoside derivative modified nucleic acid aptamer, the sequence of which comprises a sequence as shown in SEQ NO: 1, at least one nucleotide of the nucleic acid aptamer is replaced by a nucleoside derivative, and / or the tail end of the nucleic acid aptamer is connected and modified by the nucleoside derivative; preferably, the nucleoside derivative is a thymine nucleoside derivative or a cytidine nucleoside derivative.

Description

technical field [0001] The invention belongs to the technical field of biotechnology and genetic engineering, and in particular relates to a nucleic acid aptamer, which is modified by nucleoside derivatives, used for improving its stability, increasing its druggability, and improving its short half-life when applied in vivo and renal clearance. Background technique [0002] aptamer [0003] Aptamers are single-stranded DNA or RNA, usually obtained by screening (Exponential Enrichment Ligand Evolution, SELEX), and have strong affinity and specificity with ligands [1,2]. There are currently hundreds of nucleic acid aptamers based on various targets, such as organs, cells, tissues, proteins, small molecules, etc. There are also hundreds of them based on tumor cells and tumor-related proteins [3]. At present, many nucleic acid aptamers are in the clinical research stage, but only one nucleic acid aptamer targeting VEGF has been approved by the FDA for age-related macular dege...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115
CPCC12N15/115C12N2310/16C12N2310/335C12N2310/334
Inventor 谭蔚泓刘庄肖泽宇孙洋
Owner RENJI HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com