Check patentability & draft patents in minutes with Patsnap Eureka AI!

Improved bacteriophage expression carrrier

An expression vector, phagemid technology, applied in the field of molecular biology and antibody engineering, can solve the problem of inability to effectively insert single-chain antibody library and so on

Inactive Publication Date: 2005-05-25
CHINESE NAT HUMAN GENOME CENT AT SHANGHAI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, during the use of this vector, a considerable proportion of the light chain gene coding products of human immunoglobulins cannot be effectively inserted into the single chain antibody library due to various unknown factors.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Improved bacteriophage expression carrrier
  • Improved bacteriophage expression carrrier

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Modification of enzyme cleavage site of pHEN-2

[0032] The phagemid expression vector pHEN2 is a commonly used phagemid expression vector in the field (purchased from the MRC Center of the University of Cambridge, UK), and its multi-restriction site map is as follows: figure 1 and SEQ ID NO:1.

[0033] experiment method:

[0034] Synthesize the following primers:

[0035] Forward: GCTGCAGGTCGACCTCGAGTG (SEQ ID NO: 3)

[0036] Reverse: ATCGAGCTCCTGCAGTTGGACCTGCGCGCTACCGCCAGAGCCACCTC (SEQ ID NO: 4)

[0037] Using pHEN2 as a template, use the following method to transform the pHEN-2 restriction site into a BssH II restriction site.

[0038] Using the above primers for PCR, the obtained PCR product and the pHEN2 plasmid were digested with restriction endonucleases Sac I and Nco I respectively, after the two were ligated and transformed, the plasmid was extracted, and the original pHEN2 plasmid was verified by DNA sequencing. The Apa I site has been transformed into a ...

Embodiment 2

[0042] Construction of Human Single Chain Antibody Library

[0043]Synthesized more than 50 PCR primers that can be used to amplify the variable regions of human antibody heavy chain and light chain by conventional methods, extracted four human fetal livers and spleens, one human bone marrow cell and peripheral blood of 15 healthy adults The mRNA of lymphocytes; RT-PCR method was used to amplify the antibody heavy chain and light chain variable region genes from them with primers for different families of immunoglobulins respectively; they were cloned into the modified phagemid expression vector successively, and after several Hundreds of electroporations were performed to construct a human single-chain antibody library, in which pHEN-2 (control) and the improved pHEN-2 prepared in Example 1 were used respectively. Then, the phage antibody library was serially diluted and infected with E.coli TG1 bacterial fluid in the logarithmic growth phase, coated with LB ampicillin plate,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

An improved expression carrier pHEN2 used to screen the phagemid in single-chain antibody by phage display method features that the enzyme severing site ApaL1 in its multiple enzyme severing sites is removed or replaced by BssH II, so more products coded by the light-chain gene of human immunoglobulin can be effectively inserted in single-chain antibody library to ensure its diversity and high volume.

Description

technical field [0001] The invention relates to the fields of molecular biology, antibody engineering and the like. More specifically, it relates to an improved phagemid expression vector for screening single-chain antibodies by phage display method. Background technique [0002] Antibodies have been developed for hundreds of years as preparations for disease prevention, diagnosis and treatment. The early method of preparing antibodies was to immunize animals with a certain natural antigen through various channels, and mature B cell clones secreted antibodies into serum and body fluids after being stimulated by the antigen. [0003] In fact, the antibody in serum is a mixture of various monoclonal antibodies, so it is called polyclonal antibody. Polyclonal antibodies are the first step in the purposeful use of antibodies by humans. The heterogeneity of polyclonal antibodies limits further research and application on the structure and function of antibodies. [0004] The ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/33C12N15/63C12Q1/70G01N33/577
Inventor 张新韩泽广
Owner CHINESE NAT HUMAN GENOME CENT AT SHANGHAI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More