Improved bacteriophage expression carrrier
An expression vector, phagemid technology, applied in the field of molecular biology and antibody engineering, can solve the problem of inability to effectively insert single-chain antibody library and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Modification of enzyme cleavage site of pHEN-2
[0032] The phagemid expression vector pHEN2 is a commonly used phagemid expression vector in the field (purchased from the MRC Center of the University of Cambridge, UK), and its multi-restriction site map is as follows: figure 1 and SEQ ID NO:1.
[0033] experiment method:
[0034] Synthesize the following primers:
[0035] Forward: GCTGCAGGTCGACCTCGAGTG (SEQ ID NO: 3)
[0036] Reverse: ATCGAGCTCCTGCAGTTGGACCTGCGCGCTACCGCCAGAGCCACCTC (SEQ ID NO: 4)
[0037] Using pHEN2 as a template, use the following method to transform the pHEN-2 restriction site into a BssH II restriction site.
[0038] Using the above primers for PCR, the obtained PCR product and the pHEN2 plasmid were digested with restriction endonucleases Sac I and Nco I respectively, after the two were ligated and transformed, the plasmid was extracted, and the original pHEN2 plasmid was verified by DNA sequencing. The Apa I site has been transformed into a ...
Embodiment 2
[0042] Construction of Human Single Chain Antibody Library
[0043]Synthesized more than 50 PCR primers that can be used to amplify the variable regions of human antibody heavy chain and light chain by conventional methods, extracted four human fetal livers and spleens, one human bone marrow cell and peripheral blood of 15 healthy adults The mRNA of lymphocytes; RT-PCR method was used to amplify the antibody heavy chain and light chain variable region genes from them with primers for different families of immunoglobulins respectively; they were cloned into the modified phagemid expression vector successively, and after several Hundreds of electroporations were performed to construct a human single-chain antibody library, in which pHEN-2 (control) and the improved pHEN-2 prepared in Example 1 were used respectively. Then, the phage antibody library was serially diluted and infected with E.coli TG1 bacterial fluid in the logarithmic growth phase, coated with LB ampicillin plate,...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap