T1R Taste Receptors and Genes Encoding Same

a technology of t1r taste receptor and genes, applied in the field of newly identified mammalian chemosensory g proteincoupled receptors, can solve the problem of lack of information about ligand-receptor recognition

Inactive Publication Date: 2007-12-20
SENOMYX INC
View PDF39 Cites 44 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The invention is about a new family of receptors in mammals that are involved in taste perception. These receptors, called T1Rs, can be activated by different taste stimuli and can be used to predict the taste perception of mammals, including humans. The invention provides methods for using these receptors to represent the perception of taste and to predict the perception of taste in mammals. The invention also provides isolated nucleic acid sequences that encode these receptors, as well as cells that functionally express them. The invention also includes methods for screening compounds for their ability to interact with the T1Rs and for simulating the taste perception of mammals using the T1Rs. Overall, the invention provides new tools for understanding and predicting taste perception in mammals.

Problems solved by technology

Because of the complexity of ligand-receptor interactions, and more particularly taste stimulus-receptor interactions, information about ligand-receptor recognition is lacking.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • T1R Taste Receptors and Genes Encoding Same
  • T1R Taste Receptors and Genes Encoding Same
  • T1R Taste Receptors and Genes Encoding Same

Examples

Experimental program
Comparison scheme
Effect test

example 1

hT1R3

[0247] The hT1R3 genomic DNA is provided below as SEQ ID NO 1 and SEQ ID NO 2 with predicted coding sequences (cds) shown in boldface. The break between the 5′ and 3′ contigs is shown as elipses (‘ . . . ’). The hT1R3 predicted cds are described in SEQ ID NO 3. Finally, a preferred, predicted hT1R3 amino acid sequence is provided as SEQ ID NO 4, using the one-letter code for the amino acids.

hT1R3 genomic DNA - 5′ contig (SEQ ID NO: 1)(SEQ ID NO: 1)AGCCTGGCAGTGGCCTCAGGCAGAGTCTGACGCGCACAAACTTTCAGGCCCAGGAAGCGAGGACACCACTGGGGCCCCAGGGTGTGGCAAGTGAGGATGGCAAGGGTTTTGCTAAACAAATCCTCTGCCCGCTCCCCGCCCCGGGCTCACTCCATGTGAGGCCCCAGTCGGGGCAGCCACCTGCCGTGCCTGTTGGAAGTTGCCTCTGCCATGCTGGGCCCTGCTGTCCTGGGCCTCAGCCTCTGGGCTCGGTACAGAGGTGGGACGGCCTGGGTCGGGGTCAGGGTGACCAGGTCTGGGGTGCTCCTGAGCTGGGGCCGAGGTGGCCATCTGCGGTTCTGTGTGGCCCCAGGTTCTCCTCAAACGGCCTGCTCTGGGCACTGGCCATGAAAATGGCCGTCAGTGGGGCGCCCCCCACCATCACCCACCCCCAACCAACCCCTGCCCCGTGGGAGCCCCTTGTGTCAGGAGAATGChT1R3 genomic DNA - 3′ contig (SEQ ID NO 2)(SEQ ID NO 2). . ....

example 2

rT1R3 and mT1R3

[0248] Segments of the rat and mouse T1R3 genes were isolated by PCR amplification from genomic DNA using degenerate primers based on the human T1R3 sequence. The degenerate primers SAP077 (5′-CGNTTYYTNGCNTGGGGNGARCC-3′; SEQ ID NO 5) and SAP079 (5′-CGNGCNCGRTTRTARCANCCNGG-3′; SEQ ID NO 6) are complementary to human T1R3 residues RFLAWGEPA (corresponding to SEQ ID NO 7) and PGCYNRAR (corresponding to SEQ ID NO 8), respectively. The PCR products were cloned and sequenced. Plasmid SAV115 carries a cloned segment of the mouse T1R3 gene, and SAV118 carries a segment of the rat gene. These sequences, shown below, clearly represent the rodent counterparts of human T1R3, since the mouse segment is 74% identical to the corresponding segment of human T1R3, and the rat segment is 80% identical to the corresponding segment of human T1R3. The mouse and rat segments are 88% identical. No other database sequences are more than 40% identical to these T1R3 segments.

SAV115 mouse T1R...

example 3

Cloning of rT1R3

[0249] The mT1R3 and rT1R3 fragments identified above as SEQ ID NOs 9 and 11 were used to screen a rat taste tissue-derived cDNA library. One positive clone was sequenced and found to contain the full-length rT1R3 sequence presented below as SEQ ID NO 13. Sequence comparison to the mT1R3 and rT1R3 partial sequences and to the full-length hT1R3 sequence established that this cDNA represents the rat counterpart to hT1R3. For example, the pairwise amino acid identity between rT1R3 and hT1R3 is approximately 72%, whereas the most related annotated sequence in public DNA sequence data banks is only approximately 33% identical to rT1R3.

rT1R3 predicted cds (SEQ. ID NO. 13)(SEQ ID NO 13)ATGCCGGGTTTGGCTATCTTGGGCCTCAGTCTGGCTGCTTTCCTGGAGCTTGGGATGGGGTCCTCTTTGTGTCTGTCACAGCAATTCAAGGCACAAGGGGACTATATATTGGGTGGACTATTCCCCTGGGCACAACTGAGGAGGCCACTCTCAACCAGAGAACACAGCCCAACGGCATCCTATGTACCAGGTTCTCGCCCCTTGGTTTGTTCCTGGCCATGGCTATGAAGATGGCTGTAGAGGAGATCAACAATGGATCTGCCTTGCTCCCTGGGCTGCGACTGGGCTAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Tmaaaaaaaaaa
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
Login to View More

Abstract

Newly identified mammalian taste-cell-specific G protein-coupled receptors, and the genes and cDNA encoding said receptors are described. Specifically, T1R G protein-coupled receptors active in taste signaling, and the genes and cDNA encoding the same, are described, along with methods for isolating such genes and for isolating and expressing such receptors. Methods for representing taste perception of a particular taste stimulus in a mammal are also described, as are methods for generating novel molecules or combinations of molecules that elicit a predetermined taste perception in a mammal, and methods for simulating one or more tastes. Further, methods for stimulating or blocking taste perception in a mammal are also disclosed.

Description

RELATED APPLICATIONS [0001] This application claims benefit of priority to U.S. Ser. No. 60 / 259,227 filed on Jan. 3, 2001 and U.S. Ser. No. 60 / 284,547, filed on Apr. 19, 2001, both of which are incorporated by reference in their entirety herein.BACKGROUND OF THE INVENTION [0002] 1. Field of the Invention [0003] The invention relates to newly identified mammalian chemosensory G protein-coupled receptors, to family of such receptors, and to the genes and cDNA encoding said receptors. More particularly, the invention relates to newly identified mammalian chemosensory G protein-coupled receptors active in taste signaling, to a family of such receptors, to the genes and cDNA encoding said receptors, and to methods of using such receptors, genes, and cDNA in the analysis and discovery of taste modulators. The invention provides in particular a DNA sequence encoding a novel human taste receptor identified infra as T1R2 and the corresponding receptor polypeptide. [0004] 2. Description of th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N15/64A23L1/305G01N33/50C07K14/705C07K16/28C07K19/00C12M1/00C12N1/15C12N1/19C12N1/21C12N5/10C12N15/09C12N15/12C12Q1/02G01N33/15G01N33/53G01N37/00G16B5/00
CPCC07K14/705C07K2319/00G01N33/6872C12Q1/6883G01N33/5041G01N2333/726G16B5/00C07K14/723G01N33/74
InventorADLER, JON ELLIOTTLI, XIAODONGSTASZEWSKI, LENAO'CONNELL, SHAWNZOZULYA, SERGEY
OwnerSENOMYX INC