Methods for safety testing
a technology of safety testing and biological products, applied in the direction of ict adaptation, antibody medical ingredients, instruments, etc., can solve the problem of overestimating the actual number of functional oncogenes in a sampl
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
Amplification of LINE Fragments
[0167]For the PCR assay to determine the LINE fragments in the samples, the primer sequences ACTGTAGTGAGAGATGAAGAGG (SEQ ID NO: 1) and GGCGTATACCTGTTCATAAT (SEQ ID NO: 2) are used which amplify a fragment of 1002 bp of ORF2 (SEQ ID NO. 3).
[0168]The fragment size of 1000 bp is half of the mean size of a human oncogene, which is reported with 1925 bp [73]. A long range polymerase from the company New England Biolabs is used as polymerase. The LINE fragment is amplified using an initial denaturing step for 2 min. at 94° C., followed by 35 cycles of DNA amplification (94° C. for 30 sec; 53° C. for 30 sec; 72° C. for 1 min) and a final elongation step at 72° C. for 4 min.
[0169]A dilution series of the PCR product is produced and the PCR product is analysed on an agarose gel. The evaluation of the results is performed by an end point evaluation. The first negative PCR signal in the dilution series is taken for the calculation. The detection limit (DL) of the...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Mass | aaaaa | aaaaa |
| Mass | aaaaa | aaaaa |
| Concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 