Methods for safety testing

a technology of safety testing and biological products, applied in the direction of ict adaptation, antibody medical ingredients, instruments, etc., can solve the problem of overestimating the actual number of functional oncogenes in a sampl

Inactive Publication Date: 2015-06-11
NOVARTIS AG
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent text describes a new way to better evaluate the safety of cell culture-derived biological products. This method helps to more accurately assess the DNA safety factor.

Problems solved by technology

However, this method does not exclude non-functional long DNA fragments (e.g. alkylated or nicked DNA) from the calculation and so overestimates the actual number of functional oncogenes in a sample.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods for safety testing
  • Methods for safety testing
  • Methods for safety testing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

Amplification of LINE Fragments

[0167]For the PCR assay to determine the LINE fragments in the samples, the primer sequences ACTGTAGTGAGAGATGAAGAGG (SEQ ID NO: 1) and GGCGTATACCTGTTCATAAT (SEQ ID NO: 2) are used which amplify a fragment of 1002 bp of ORF2 (SEQ ID NO. 3).

[0168]The fragment size of 1000 bp is half of the mean size of a human oncogene, which is reported with 1925 bp [73]. A long range polymerase from the company New England Biolabs is used as polymerase. The LINE fragment is amplified using an initial denaturing step for 2 min. at 94° C., followed by 35 cycles of DNA amplification (94° C. for 30 sec; 53° C. for 30 sec; 72° C. for 1 min) and a final elongation step at 72° C. for 4 min.

[0169]A dilution series of the PCR product is produced and the PCR product is analysed on an agarose gel. The evaluation of the results is performed by an end point evaluation. The first negative PCR signal in the dilution series is taken for the calculation. The detection limit (DL) of the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Massaaaaaaaaaa
Massaaaaaaaaaa
Concentrationaaaaaaaaaa
Login to View More

Abstract

The invention provides improved methods for the safety testing of compositions which comprise biological products produced in a host cell, such as vaccine antigens or recombinant proteins.

Description

[0001]This patent application claims priority from U.S. provisional patent application 61 / 655,178, filed Jun. 4, 2012, the complete contents of which are incorporated herein by reference.[0002]This invention was made in part with Government support under grant no. HHSO100200600012C. The Government has certain rights in the invention.TECHNICAL FIELD[0003]This invention is in the field of safety testing for biological products.BACKGROUND ART[0004]To characterize the risk of residual DNA in cell derived vaccines, a DNA safety factor can be determined. The safety factor indicates the number of vaccine doses that an individual must be injected with in order to trigger a tumorigenic event with a probability of at least 5%. In 2005, the US Food and Drug Administration (FDA) recommended a safety factor of >107 for vaccines with antigens that were prepared in mammalian cell culture [1].[0005]Previously the safety of cell culture based biological products was assessed by determining the re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G06F19/00C12Q1/70
CPCG06F19/706C12Q2600/158C12Q1/701C12Q1/6827C12Q1/6886A61K39/00G16C20/50A61P31/12A61P31/16Y02A50/30Y02A90/10C12Q2537/16
InventorTRUSHEIM, HEIDIRATHAJ HAMMER, LINDAWILMS, REINHARDHOYER, WALTER
OwnerNOVARTIS AG