Chimeric protein in the treatment of amyloidosis
a chimeric protein and amyloidosis technology, applied in the field of specific chimeric proteins for therapeutic use, can solve the problems of difficult access to certain organs, no treatment that can accelerate the elimination of amyloidosis, and numerous side effects, and achieves the effects of reducing the number of side effects, and facilitating the recognition of amyloidosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Construction of the Monomeric SAP-Fc Vector
[0270]A) Amplification of the cDNA Fragment Encoding Human SAP:
[0271]For the construction of the monomeric SAP-Fc vector, the human amyloid P component (SAP) was amplified from human cDNA with the Phusion Taq polymerase. The STOP codon was not amplified. A Kozak sequence was added upstream of the starting ATG of the sequence. The sequence was bordered by 2 SalI restriction sites, added in the primers used for the amplification. What is more, in the sequence considered, only the 2 exons making up the SAP are present, the intron not being in this construct.
[0272]The human SAP cDNA sequence used, corresponding to the sequence SEQ ID NO: 28 hereinafter, is therefore the following:
GTCGACACCATGAACAAGCCGCTCTTTGGATCTCTGTCCTCACCAGCCTCCTGGAAGCCTTTGCTCACACAGACCTCAGTGGGAAGGTGTTTGTATTTCCTAGAGAATCTGTTACTGATCATGTAAACTTGATCACACCGCTGGAGAAGCCTCTACAGAACTTTACCTTGTGTTTTCGAGCCTATAGTGATCTCTCTCGTGCCTACAGCCTCTTCTCCTACAATACCCAAGGCAGGGATAATGAGCTACTAGTTTATAAAGAAAGAGTT...
example 2
Construction of the Monomeric SAP-ScFc Vector
[0289]A) Amplification of the DNA Fragment Encoding Human SAP:
[0290]See example 1.A) above.
[0291]B) Amplification of the First Fragment of cDNA Encoding the First Fragment of an Fc Region of a Human Antibody
[0292]The nucleic acid encoding the first fragment of an Fc region of a human antibody was amplified from a laboratory vector containing the cDNA of a human IgG1 (IGHG1*03). The amplification of the Fc domain sequence was carried out with the Phusion Taq polymerase. The Fc fragment was bordered by 2 restriction sites, XhoI and HindIII, added in the primers during the amplification. The STOP codon was not amplified.
[0293]The cDNA sequence encoding the first fragment of an Fc region of a human antibody, corresponding to the sequence SEQ ID NO: 32 hereinafter, is the following sequence:
GCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGT...
example 3
Production of SAP-Fc / ScFc Chimeric Proteins According to the Invention
[0314]A) Transformation of SP2 / 0, CHO and YB2 / 0 Cells by Electroporation
[0315]The transfection is carried out using the Nucleofector™ electroporation protocol (Lonza). The cells in the exponential phase are centrifuged for 5 min at 300 g and resuspended in PBS. After counting, the required amount is pelleted by centrifugation (300 g, 5 min) and taken up in 100 μl of Nucleofector™ solution V buffer. 2.5×106 SP2 / 0 cells or 1×106 CHO cells are transfected with 2.5 μg of linearized vector. After electroporation, the cells are put back into complete medium and distributed in 96-well plates at 1000 cells per well for the SP2 / 0 cells and 100 cells per well for the CHO cells. The optimal clonality conditions were established according to the efficiency of the electroporation program chosen and the nature of the line used. The selection of the clones having stably integrated the expression vector is carried out by adding n...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Temperature | aaaaa | aaaaa |
| Time | aaaaa | aaaaa |
| Fraction | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 