Chimeric protein in the treatment of amyloidosis

a chimeric protein and amyloidosis technology, applied in the field of specific chimeric proteins for therapeutic use, can solve the problems of difficult access to certain organs, no treatment that can accelerate the elimination of amyloidosis, and numerous side effects, and achieves the effects of reducing the number of side effects, and facilitating the recognition of amyloidosis

Inactive Publication Date: 2016-09-15
CENT NAT DE LA RECHERCHE SCI +2
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The invention relates to a chimeric protein that can help eliminate amyloid substance deposits in the body, improving the clinical condition of patients with amyloid plaque buildup. The protein can recruit effector cells to attack the deposits, resulting in a more effective treatment for amyloid plaque buildup in organs.

Problems solved by technology

It therefore requires targeted biopsies, but it is more difficult to gain access to certain organs or there is a not insignificant risk (heart, brain, etc.) Amyloid substances can be specifically recognized using a dye, Congo red, by observing yellow-green dichroic birefringence in polarized light.
At the current time, there is no treatment that can accelerate the elimination of the deposits.
Chemotherapy treatment for AL amyloidosis comprises, however, numerous side effects such as hair loss, diarrhea, nausea or vomiting.
At a very advanced stage of AL amyloidosis, the damage in the organs is such that chemotherapy is ineffective.
However, for the moment, this amyloidosis remains incurable and fatal, since there is no specific treatment that can eliminate the deposits more rapidly.
Furthermore, this treatment is not effective when it is begun at an advanced pathological stage, in particular when there is cardiac involvement.
However, it appears that these treatments, although they cause a delay in the appearance of the amyloid deposits, inhibit however their elongation little or not at all (Merlini G, Blood 93, 1999: 1112).
However, it appears that these antibodies do not seem to be very effective.
However, the drawback of this strategy is that it requires a prior step of administering (R)-1-[6-[(R)-2-carboxypyrrolidin-1-yl]-6-oxohexanoyl]pyrrolidine-2-carboxylic acid (CPHPC) so as to eliminate the circulating SAP (Pepys M B et al., Nature, 2010, 468(7320): 93-7).

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric protein in the treatment of amyloidosis
  • Chimeric protein in the treatment of amyloidosis
  • Chimeric protein in the treatment of amyloidosis

Examples

Experimental program
Comparison scheme
Effect test

example 1

Construction of the Monomeric SAP-Fc Vector

[0270]A) Amplification of the cDNA Fragment Encoding Human SAP:

[0271]For the construction of the monomeric SAP-Fc vector, the human amyloid P component (SAP) was amplified from human cDNA with the Phusion Taq polymerase. The STOP codon was not amplified. A Kozak sequence was added upstream of the starting ATG of the sequence. The sequence was bordered by 2 SalI restriction sites, added in the primers used for the amplification. What is more, in the sequence considered, only the 2 exons making up the SAP are present, the intron not being in this construct.

[0272]The human SAP cDNA sequence used, corresponding to the sequence SEQ ID NO: 28 hereinafter, is therefore the following:

GTCGACACCATGAACAAGCCGCTCTTTGGATCTCTGTCCTCACCAGCCTCCTGGAAGCCTTTGCTCACACAGACCTCAGTGGGAAGGTGTTTGTATTTCCTAGAGAATCTGTTACTGATCATGTAAACTTGATCACACCGCTGGAGAAGCCTCTACAGAACTTTACCTTGTGTTTTCGAGCCTATAGTGATCTCTCTCGTGCCTACAGCCTCTTCTCCTACAATACCCAAGGCAGGGATAATGAGCTACTAGTTTATAAAGAAAGAGTT...

example 2

Construction of the Monomeric SAP-ScFc Vector

[0289]A) Amplification of the DNA Fragment Encoding Human SAP:

[0290]See example 1.A) above.

[0291]B) Amplification of the First Fragment of cDNA Encoding the First Fragment of an Fc Region of a Human Antibody

[0292]The nucleic acid encoding the first fragment of an Fc region of a human antibody was amplified from a laboratory vector containing the cDNA of a human IgG1 (IGHG1*03). The amplification of the Fc domain sequence was carried out with the Phusion Taq polymerase. The Fc fragment was bordered by 2 restriction sites, XhoI and HindIII, added in the primers during the amplification. The STOP codon was not amplified.

[0293]The cDNA sequence encoding the first fragment of an Fc region of a human antibody, corresponding to the sequence SEQ ID NO: 32 hereinafter, is the following sequence:

GCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGT...

example 3

Production of SAP-Fc / ScFc Chimeric Proteins According to the Invention

[0314]A) Transformation of SP2 / 0, CHO and YB2 / 0 Cells by Electroporation

[0315]The transfection is carried out using the Nucleofector™ electroporation protocol (Lonza). The cells in the exponential phase are centrifuged for 5 min at 300 g and resuspended in PBS. After counting, the required amount is pelleted by centrifugation (300 g, 5 min) and taken up in 100 μl of Nucleofector™ solution V buffer. 2.5×106 SP2 / 0 cells or 1×106 CHO cells are transfected with 2.5 μg of linearized vector. After electroporation, the cells are put back into complete medium and distributed in 96-well plates at 1000 cells per well for the SP2 / 0 cells and 100 cells per well for the CHO cells. The optimal clonality conditions were established according to the efficiency of the electroporation program chosen and the nature of the line used. The selection of the clones having stably integrated the expression vector is carried out by adding n...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Temperatureaaaaaaaaaa
Timeaaaaaaaaaa
Fractionaaaaaaaaaa
Login to View More

Abstract

The present invention relates to a chimeric protein comprising at least one human amyloid P component and at least one fragment of an Fc region of a human antibody, the human amyloid P component and the fragment of an Fc region with which it is associated being bound to each other by means of a hinge region.

Description

FIELD OF THE INVENTION[0001]The present invention relates to the field of obtaining a specific chimeric protein for therapeutic use, in particular for treating amyloidosis, in particular amyloidosis of AL type.PRIOR ART[0002]Amyloidosis is a vast group of diseases belonging to the group of protein conformational diseases encompassing other diseases such as, for example, Alzheimer's disease, transmissible spongiform encephalopathies, Huntington's disease or type II diabetes.[0003]Amyloidosis is a rare disease which is characterized by the presence of deposits of insoluble proteins which adopt an abnormal fibrillar conformation in the tissues. Most commonly, it is serum precursor protein fragments which are the cause thereof. Many organs can be affected by these extracellular deposits, called “amyloid substance”. The main organs affected by the amyloid deposits are the kidney, the heart, the digestive tract, the liver, the skin, peripheral nerves and the eye. The organs affected by th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/47A61K38/17G01N33/68A61K45/06
CPCC07K14/4711A61K45/06A61K38/1716G01N2800/2828C07K2319/30G01N2800/2821G01N2800/2835G01N33/6896C07K14/47C12N15/62C07K2319/00A61P43/00
InventorROMEUF, CHRISTOPHE DESIRAC, CHRISTOPHE
OwnerCENT NAT DE LA RECHERCHE SCI