Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anti-pd-l1 combinations for treating tumors

a combination therapy and tumor technology, applied in the direction of antibody medical ingredients, drug compositions, peptides, etc., can solve the problems of signal abrogation, cell death, and difficult to achieve long-term efficient inhibition and killing of tumor cells by the simple majority of antibodies, and the current antibody-drug conjugate drugs are limited in how to kill tumor cells directly

Inactive Publication Date: 2017-04-27
BIRDIE BIOPHARM INC
View PDF1 Cites 32 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present invention provides a therapeutic combination of a PD-L / PD-1 Axis antagonist and an immunotherapeutic that can activate human plasmacytoid dendritic cells, myeloid dendritic cells, or NK cells. The combination can be used to treat various cancers or immunological disorders. The immunotherapeutic can be a single-stranded RNA, a receptor ligand analog, or a compound of Formula (I) to (XIXb). The patent text also describes the use of the combination in a method of treating cancer or immunological disorders.

Problems solved by technology

Binding of antibodies to an enzyme can lead to neutralization, signal abrogation, and cell death.
However, some issues still need further study to be solved, such as antibody immunogenicity, tolerance of long-term use of tumor target, and long-term effects of simple single blockade of signal transduction pathway.
In short, a simple majority of antibodies are difficult to achieve long-term efficient inhibition and killing of tumor cells.
Current antibody-drug conjugates drugs are limited in how to kill tumor cells directly.
However, because of the tough requirement of technologies in antibody, linker molecule, toxin molecules, and conjugation, as well as the limitation of bringing toxins within the tumor microenvironment molecules, there are still some difficulties in actual clinical studies.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-pd-l1 combinations for treating tumors
  • Anti-pd-l1 combinations for treating tumors
  • Anti-pd-l1 combinations for treating tumors

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0409]Tumour Inoculation and Evaluation of Tumour Growth

[0410]Mice: Female 6-week-old BALB / c and C3H / HeN (C3H) mice were purchased from Japan SLC (Hamamatsu, Japan). All procedures were reviewed and approved by the Animal Care and Use Committee of the Tokyo Medical and Dental University. The SCCVII (C3H-originated, 3×105), or Colon26 (BALB / c-originated, 5×105) parental cells were injected subcutaneously (s.c.) into the shaved right flank of syngeneic mice and tumour volumes were evaluated. In experiments examining the effects of anti-PDL1(MIH5) mAb with TLRL, 200 ug of anti-PDL1 mAb or 200 ug of anti-PDL1 mAb mixture with TLRL or control rat IgG was injected i.p. three times a week after tumour inoculation. Tumor volumes were measured along three orthogonal axes (x, y, and z) and calculated as tumor volume=(xyz) / 2, if a mouse lose more than 20% of body weight or is very sick and cannot get to adequate food or water, it will be removed from the study and euthanized. (FIGS. 1 and 2)

example 2

[0411]Enrichment of Human Dendritic Cells (DCs) from PBMC

[0412]Human PBMC was prepared from Buffy coats obtained from healthy volunteer donors by Ficoll centrifugation. Dendritic cells were enriched by using negative depletion with magnetic beads (Miltenyi Biotec Inc. San Diego, Calif.) with mixture of anti-CD3, CD19, CD20, CD14, and CD16 antibodies from human PBMC. The enrichment of DCs was stained with goat anti-mouse FITC (lineages), HLA-DR-APCCy7, CD123-BV421 and CD11C-APC. The stained cells were analyzed on BD LSR Fortessa (BD Biosciences). The anti-CD3, CD4, CD11C, CD19, CD14, CD16, CD123 monoclonal antibody were purchased from BD Biosciences, CA or Biolegend, San Diego, Calif.

[0413]Stimulation of Enriched Human DCs and Cytokines Expression

[0414]1-2×105 enriched DCs were plated in a 96-well plate in 100 μl media, 100 μl diluted stimulators (including TLRL were add to the plate and cultured for 20-22h in 37° C. incubator. The supernatant were collected and human IFN-α, IL-12(p7...

example 3

[0416]Detection of Systemic Immune Activation with IFN Inducible Genes Expression in Mouse PBMC by TLRL

[0417]Balb / c mice, 6-8 weeks of age, female, purchased from Vital River were injected intravenously with TLRL, at indicated time point, mice were bled and IFN inducible genes were examined by qPCR. Once pick time of expression IFN inducible genes was determined, a separated experiment was performance with various dose of TLRL. At indicated time point, mice were bled and IFN inducible genes were examined. The Quantitative Real-Time PCR was performed and gene expression data were normalized relative to geometric mean of two housekeeping genes (Actin):

Mouse Actin: (SEQ ID NO.: 1)F: CATTGCTGACAGGATGCAGAAGG,Mouse Actin (SEQ ID NO.: 2)R: TGCTGGAAGGTGGACAGTGAGG;Mouse Inf-b: (SEQ ID NO.: 3)F: CTCCAGCACTGGGTGGAATG,Mouse Inf-b (SEQ ID NO.: 4)R: AGTGGAGAGCAGTTGAGGAC;Mouse Mx2: (SEQ ID NO.: 5)F; GTGGCAGAGGGAGAATGTCG,Mouse Mx2(SEQ ID NO.: 6)R: TAAAACAGCATAACCTTTTGCG;Mouse Ifn-a: (SEQ ID NO.: 7)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
diameteraaaaaaaaaa
diametersaaaaaaaaaa
Login to View More

Abstract

The present invention relates to therapeutic combinations and methods for treating cancers using combination therapy.

Description

CROSS REFERENCE TO RELATED APPLICATIONS[0001]This application claims the benefit of, and priority to, PCT application PCT / CN2015 / 083585, filed Jul. 8, 2015, Chinese Patent Application Serial Nos. 201410325480.9, filed Jul. 9, 2014, and 201410440824.0, filed Sep. 1, 2014, the entire disclosures of which are hereby incorporated by reference in their entireties.FIELD OF THE INVENTION[0002]The present invention relates to therapeutic combinations and methods for treating cancers using combination therapy.BACKGROUND OF THE INVENTION[0003]Therapeutic antibodies have been used in clinical applications for over twenty years. Currently, there are fifteen anti-tumor antibody drugs in clinic, including Rituxan (1997), Herceptin (1998), Mylotarg (2000), Campath (2001), Zevalin (2002), Bexxer (2003), Avastin (2004), Erbitux (2004), Vectibix (2006), Arzerra (2009); Benlysta (2011); Yervoy (2011), Adcetris (2011), Perjeta (2012), and Kadcyla (2013). These antibodies target mainly four molecules: E...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C07K16/28A61K31/4745C07K16/30A61K39/395A61K45/06
CPCC07K16/2827A61K2039/505A61K39/39558A61K45/06C07K16/3015C07K16/3023C07K16/3038C07K16/303C07K16/3046C07K16/3053C07K16/3069C07K16/3061A61K31/4745C07K2317/76C07K16/2818A61K31/4375A61K31/708A61K31/4985A61K31/519A61K31/52A61K31/522A61K31/55A61K31/5513A61K31/7064A61P35/00A61K2300/00
Inventor LI, LIXIN
Owner BIRDIE BIOPHARM INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com