Methods for increasing cas9-mediated engineering efficiency

a technology of cas9 and engineering efficiency, applied in the field of type ii crisprcas9 systems, can solve the problems of inefficient site-directed breakage repair by hdr at target nucleic acid site, and achieve the effect of reducing binding and/or cleavage of off-target nucleic acid and reducing binding and/or cleavag

Inactive Publication Date: 2018-06-21
CARIBOU BIOSCI
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This approach significantly reduces off-target binding and cleavage, increasing the precision of Cas9-mediated genome engineering and enhancing homology-directed repair efficiency, thereby improving the accuracy of genome editing processes.

Problems solved by technology

Faithful repair by HDR is inefficient at site-directed breaks of the target nucleic acid because other cellular mechanisms may result in the incorporation of nucleic acids at the site of a double-stranded break or a single-stranded nick.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods for increasing cas9-mediated engineering efficiency
  • Methods for increasing cas9-mediated engineering efficiency
  • Methods for increasing cas9-mediated engineering efficiency

Examples

Experimental program
Comparison scheme
Effect test

example 1

Production of dCas9 Nuclease Blocker and Cas9 Nuclease Components

[0197]sgRNA components of dCas9 nuclease-blocker (dCas9-NB, i.e. a Cas9 lacking catalytic activity) ribonucleoprotein (RNP) complexes (also termed “sgRNA / dCas9 complex” herein) and catalytically active Cas9 nuclease RNP complexes (also termed “sgRNA / Cas9 complex” herein) were produced by in vitro transcription (e.g., T7 Quick High Yield RNA Synthesis Kit, New England Biolabs, Ipswich, Mass.) from double-stranded DNA templates incorporating a T7 promoter at the 5′ end of the DNA sequence. Polymerase Chain Reaction (PCR) using 5′ overlapping primers was used to assemble the double-stranded DNA templates for transcription of sgRNA components. The sgRNA components, templates and primers used are identified in Table 1. The sequences of the oligonucleotide primers used in the assembly are presented in Table 2.

TABLE 1Overlapping Primers for Generation of dCas9-NB and Cas9 NucleasesgRNA Component TemplatesComponentTarget for D...

example 2

Deep Sequencing Analysis for Detection of Target Modifications in Eukaryotic Cells

[0201]This example illustrates the use of a MiSeq Sequencer (Illumina, San Diego, Calif.) for deep sequencing analysis to evaluate and compare the DNA cleavage (as inferred from non-homologous end joining, or NHEJ) of selected Cas9 nuclease off-target sequences in the presence and absence of dCas9-NBs. In this example, Cas9 was directed by a specific sgRNA to a sequence (GGGTGGGGGGAGTTTGCTCCTGG, SEQ ID NO:82) within the human gene Vascular Endothelial Growth Factor A (VEGFA). dCas9 was directed towards an off-target, sequence (GGATGGAGGGAGTTTGCTCCTGG, SEQ ID NO:83) known to be targeted by Cas9 RNP nuclease off-target to prevent off-target cleavage as well as a sequence (GGGGCCACTAGGGACAGGATTGG, SEQ ID NO:84) within the control locus, Adeno-Associated Virus Integration Site 1 (AAVSJ).

[0202]A. Transfection of Cas9 / dCas9-NB RNPs:

[0203]To assemble Cas9 and dCas9 RNPs, 1.3 μl of sgRNA (corresponding to appr...

example 3

Identification of Cas9 RNP Off-Target Loci

[0223]This example illustrates the method through which off-target Cas9 nuclease sites may be identified. The method presented here is adapted from Tsai et. al., “GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases.,” Nat Biotechnol., 2015 February; 33(2):187-97.

[0224]A. Identify a Target-Site of Interest:

[0225]A given locus in a genome of interest (i.e. a human genome) is screened using bioinformatics approaches known to those skilled in the art to identify Cas9 target-sites. A 20 base pair target-site, followed by an NGG protospacer adjacent motif (PAM), is selected for nuclease targeting.

[0226]B. Assemble GUIDE-Seq Components:

[0227]Oligos are obtained (Integrated DNA Technologies, Coralville, Iowa) for generating a blunt, double-stranded oligodeoxynucleotide (dsODN) that will be utilized for the GUIDE-Seq method. The dsODN contains phosphothiorate linkages at the 5′ ends of both DNA strands. The dsODN is...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Methods for use with Type II CRISPR-Cas9 systems for increasing Cas9-mediated genome engineering efficiency are disclosed. The methods can be used to decrease the number of off-target nucleic acid double-stranded breaks and / or to enhance homology-directed repair of a cleaved target nucleic acid.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application claims the benefit under 35 U.S.C. § 119(e)(1) of U.S. Provisional Application Nos. 62 / 042,358, filed Aug. 27, 2014 and 62 / 047,495, filed Sep. 8, 2014, each of which applications is incorporated herein by reference in its entirety.TECHNICAL FIELD[0002]The present invention relates to Type II CRISPR-Cas9 systems for use in increasing Cas9-mediated genome engineering efficiency by either decreasing the number of off-target nucleic acid double-stranded breaks, and / or enhancing homology-directed repair of a cleaved target nucleic acid.BACKGROUND OF THE INVENTION[0003]Clustered regularly interspaced short palindromic repeats (CRISPR) and associated Cas9 proteins constitute the CRISPR-Cas9 system. This system provides adaptive immunity against foreign DNA in bacteria (Barrangou, R., et al., “CRISPR provides acquired resistance against viruses in prokaryotes,” Science (2007) 315:1709-1712; Makarova, K. S., et al., “Evolution and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N15/90C12N9/22C12N15/10C12N15/11
CPCC12N9/22C12N15/907C12N15/102C12N15/111C12Y301/30C12N2310/10C12N2310/20A61K48/00C12N15/09C12N15/11
InventorCAMERON, PETER SEANHAURWITZ, RACHEL E.MAY, ANDREW P.NYE, CHRISTOPHER H.VAN OVERBEEK, MEGAN
OwnerCARIBOU BIOSCI