Detection chip for tanshinol related gene, preparation and detection method thereof
A detection chip and detection method technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, etc., to achieve strong specificity and strong scientific effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0068] The present invention is further described in detail by the following examples, which are illustrative, not restrictive, and the protection scope of the present invention cannot be limited by the following examples.
[0069] In the gene chip for detecting the content of danshensu, probes for detecting danshenin are arranged on a matrix, and the matrix used in the gene chip is a glass slide.
[0070] The probe sequence is:
[0071] Danshensu related gene probe
[0072] number sequence
[0073] No. 1: 5′CTTGGCAGGTCGAGAACTTGCTACACGGGCCCTTATGCTCGTTCGGGTCCATGTCACATG3′
[0074] No. 2: 5′TCCAGTCGAAGTTATGAACCAGAGTCGCCGTAGCCATGTGCAGGATCCGGGTCGCGAGCG3′
[0075] No. 3: 5′AGCGACGATCCACACCACAGAGGGTCTAAAAATGACAGTTACGCGAAGGCAACGAGCTCC3′
[0076] No. 4: 5′CCGCCCATACTAGCACCCCGTAGTTGTGTCCGTTCCACCCGCGATCAAAAACCTGGCTCG3′
[0077] No. 5: 5′CCGCCCATACTAGCACCACCGTAGTTGTGTCCGTTCCACCCGCGATCAAAAACCTGGCTCG3′
[0078] No. 6: 5′TACTTCTTCAACCACTTCGCCAGGGCCATCACCATTCTCTC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com