Unlock instant, AI-driven research and patent intelligence for your innovation.

Platinum kind anti-cancer drugs susceptibility related gene inspect reagent kit and applications thereof

A gene detection and anti-cancer drug technology, which is applied in the direction of analyzing materials through chemical reactions and analyzing materials through observation of the impact on chemical indicators, can solve the problems of high detection costs, achieve high sensitivity, and be easy to use And, using cheap effects

Inactive Publication Date: 2010-11-03
ZHEJIANG CANCER HOSPITAL
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The purpose of the present invention is to overcome the quantitative PCR probe method technology needs to design and synthesize sequence-specific probes, the shortcomings of high detection costs, using SYBR Green I dye quantitative PCR technology, to provide a platinum anticancer drug sensitivity correlation Gene detection kit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Platinum kind anti-cancer drugs susceptibility related gene inspect reagent kit and applications thereof
  • Platinum kind anti-cancer drugs susceptibility related gene inspect reagent kit and applications thereof
  • Platinum kind anti-cancer drugs susceptibility related gene inspect reagent kit and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] The present invention is made up of box body 1, liner 2, dye method (SYBR Green I dyestuff) PCR reaction liquid 3, Taq enzyme 4, standard substance 5, negative control 6, positive control 7, and liner 2 is provided with container hole, Place dye method (SYBR Green I dye) PCR reaction solution 3, Taq enzyme 4, standard substance 5, negative control 6, and positive control 7 respectively.

[0044] The components of the PCR reaction solution include: PCR buffer, SYBR Green I dye, MgCl 2 , dNTPs, primers for detection.

[0045] There are two pairs of primers for detection: detection gene, excision repair cross-complementation gene (ERCC1); housekeeping gene: glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

[0046] The ERCC1 primer sequence: ERCC1-F CTGCTTGTCCAGGTGGATGTGAA

[0047] ERCC1-R AGGAGGGTCTGACTGTCCGTTTT

[0048] GAPDH primer sequence: GAPDH-F GAAGGTGAAGGTCGGAGTC

[0049] GAPDH-R GAAGATGGTGATGGGATTTC

[0050] The ERCC1 standa...

Embodiment 2

[0062] Example 2 SYBR Green I Fluorescent Dye PCR Technology Detection of ERCC1 Expression and Application

[0063] 1. Materials:

[0064] The tissue total RNA extraction kit was purchased from Qiagen Company of the United States, the reverse transcription kit, and SYBRGreen I fluorescent dye were purchased from Invitrogen Company of the United States. -T Easy cloning system, Taq DNA polymerase was purchased from Promega, USA. Model 7500 quantitative PCR instrument is a product of ABI Company in the United States.

[0065] 2. Primer and probe design and synthesis:

[0066] Using the full-length cDNA sequences of ERCC1 and GAPDH (GeneBank accession numbers NM-202001 and NM-002046, respectively) as templates, in www.idtdna.com Design and analyze primers online, and select the best combination according to the genomic DNA sequence.

[0067] The primers for standard PCR and detection PCR have the same sequence,

[0068] ERCC 1-F CTGCTTGTCCAGGTGGATGTGAA

[0069] ERCC 1-R AG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
correlation coefficientaaaaaaaaaa
Login to View More

Abstract

A platinum anticarcinogen sensitivity relevant gene detection reagent kit comprises a box 1, a lining 2, a dye method PCR reaction solution 3, Taq enzyme 4, a standard sample 5, a negative control 6 and a positive control 7. Wherein, container holes are arranged on the lining 2 to respectively hold the dye method PCR reaction solution 3, the Taq enzyme 4, the standard sample 5, the negative control 6 and the positive control 7. The present invention avoids defects of SYBR Green I fluorescent dyes and nonspecific dissipation, maintains high PCR sensitivity and greatly improves specificity of detected genes by optimizing PCR primers, SYBR Green I fluorescent dyes and PCR conditions. With rational design, the present invention rejects designing a fluorescence probe, brings convenience and ensures lower price compared with prior probe methods and applies to the detection of genes in connection of platinum anticarcinogen sensitivity.

Description

technical field [0001] The invention belongs to the field of biological technology, and relates to a detection kit for genes related to sensitivity of platinum anticancer drugs, which uses SYBR GREEN I fluorescence quantitative PCR to detect genes related to sensitivity of platinum anticancer drugs in tumor tissues, and excises and repairs cross-linked genes. Kit for mRNA expression levels of a complementary gene (ERCC1). technical background [0002] Chemotherapy is one of the important methods in the treatment of malignant tumors. However, the current chemotherapy effect of most solid tumors is not satisfactory, and the expected purpose cannot be achieved. Because cancer patients have different responses to chemotherapy, there are also differences in sensitivity to chemotherapy drugs, and clinicians often use the same chemotherapy drug or the same set of chemotherapy regimens for different cancer patients based on experience, which obviously has a certain degree of blindn...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68G01N21/78
Inventor 马胜林苏丹
Owner ZHEJIANG CANCER HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More