Detection reagent kit for porcine propagate and breath complex virus and uses thereof
A technology for respiratory syndrome and pig reproduction, which is applied to the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of expensive fluorescent probes, unsuitable for basic application, etc., and achieves simple and convenient operation, high sensitivity and specificity. high effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Embodiment 1, the preparation of porcine reproductive and respiratory syndrome virus detection kit
[0061] 1. Synthesis of primers
[0062] Artificially synthesize the following 3 pairs of primers:
[0063] F3: GTGAATTGGAATATGGTAACTGC;
[0064] B3: CCATTCCCTGCCATCCTC;
[0065] FIP: CGATGGTGAGAGGGTGGATGTTTTCAAACTCCAATAGGGGCG;
[0066] BIP: CTTGCGACTGGGCTCAGAAATTTTCTGCTATAGCTCCAAATAGTCC;
[0067] LF: TGTGGAATGGCATACTAGAGTT;
[0068] LB: AGCCCTCAAGGAGAGAGA.
[0069] 2. Preparation of LAMP reaction solution
[0070] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , Tween20 0.025 μL, 0.2 μmol MgSO 4 , 20 μmol betaine (Betaine), four deoxynucleotides (dNTPs) each 0.035umol, 0.04 μmol upstream inner primer (FIP), 0.04 μmol downstream inner primer (BIP), 0.004 μmol upstream outer primer (F3), 0.004 μmol Downstream outer primer (B3), 0.02 μmol upstream circular primer (LF), 0.02 μmol down...
Embodiment 2
[0073] Embodiment 2, the preparation of porcine reproductive and respiratory syndrome virus detection kit
[0074] 1. Synthesis of primers
[0075] Same as Step 1 of Example 1.
[0076] 2. Preparation of LAMP reaction solution
[0077] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , Tween20 0.025μL, 20μmol MgSO 4 , 20 μmol betaine (Betaine), four deoxynucleotides (dNTPs) each 0.035umol, 0.06 μmol upstream inner primer (FIP), 0.06 μmol downstream inner primer (BIP), 0.008 μmol upstream outer primer (F3), 0.008 μmol Downstream outer primer (B3), 0.04 μmol upstream circular primer (LF), 0.04 μmol downstream circular primer (LB), 16 U of Bst DNA polymerase, 0.2 U of AMV reverse transcriptase, sterile double distilled water.
[0078] 3. Assembly of kit
[0079] Same as Step 3 of Example 1.
Embodiment 3
[0080] Embodiment 3, the preparation of porcine reproductive and respiratory syndrome virus detection kit
[0081] 1. Synthesis of primers
[0082] Same as Step 1 of Example 1.
[0083] 2. Preparation of LAMP reaction solution
[0084] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , Tween20 0.025μL, 10μmol MgSO 4 , 20 μmol betaine (Betaine), four deoxynucleotides (dNTPs) each 0.035umol, 0.05 μmol upstream inner primer (FIP), 0.05 μmol downstream inner primer (BIP), 0.006 μmol upstream outer primer (F3), 0.006 μmol Downstream outer primer (B3), 0.03 μmol upstream circular primer (LF), 0.03 μmol downstream circular primer (LB), 16 U of Bst DNA polymerase, 0.2 U of AMV reverse transcriptase, sterile double distilled water.
[0085] 3. Assembly of kit
[0086] Same as Step 3 of Example 1.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 