Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection reagent kit for porcine propagate and breath complex virus and uses thereof

A technology for respiratory syndrome and pig reproduction, which is applied to the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of expensive fluorescent probes, unsuitable for basic application, etc., and achieves simple and convenient operation, high sensitivity and specificity. high effect

Inactive Publication Date: 2010-09-01
CHINA AGRI UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Molecular biology diagnostic methods are faster and more sensitive than the first two methods, but require special instruments, such as PCR machines, and the preparation of fluorescent probes is relatively expensive, which is not suitable for grassroots applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection reagent kit for porcine propagate and breath complex virus and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Embodiment 1, the preparation of porcine reproductive and respiratory syndrome virus detection kit

[0061] 1. Synthesis of primers

[0062] Artificially synthesize the following 3 pairs of primers:

[0063] F3: GTGAATTGGAATATGGTAACTGC;

[0064] B3: CCATTCCCTGCCATCCTC;

[0065] FIP: CGATGGTGAGAGGGTGGATGTTTTCAAACTCCAATAGGGGCG;

[0066] BIP: CTTGCGACTGGGCTCAGAAATTTTCTGCTATAGCTCCAAATAGTCC;

[0067] LF: TGTGGAATGGCATACTAGAGTT;

[0068] LB: AGCCCTCAAGGAGAGAGA.

[0069] 2. Preparation of LAMP reaction solution

[0070] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , Tween20 0.025 μL, 0.2 μmol MgSO 4 , 20 μmol betaine (Betaine), four deoxynucleotides (dNTPs) each 0.035umol, 0.04 μmol upstream inner primer (FIP), 0.04 μmol downstream inner primer (BIP), 0.004 μmol upstream outer primer (F3), 0.004 μmol Downstream outer primer (B3), 0.02 μmol upstream circular primer (LF), 0.02 μmol down...

Embodiment 2

[0073] Embodiment 2, the preparation of porcine reproductive and respiratory syndrome virus detection kit

[0074] 1. Synthesis of primers

[0075] Same as Step 1 of Example 1.

[0076] 2. Preparation of LAMP reaction solution

[0077] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , Tween20 0.025μL, 20μmol MgSO 4 , 20 μmol betaine (Betaine), four deoxynucleotides (dNTPs) each 0.035umol, 0.06 μmol upstream inner primer (FIP), 0.06 μmol downstream inner primer (BIP), 0.008 μmol upstream outer primer (F3), 0.008 μmol Downstream outer primer (B3), 0.04 μmol upstream circular primer (LF), 0.04 μmol downstream circular primer (LB), 16 U of Bst DNA polymerase, 0.2 U of AMV reverse transcriptase, sterile double distilled water.

[0078] 3. Assembly of kit

[0079] Same as Step 3 of Example 1.

Embodiment 3

[0080] Embodiment 3, the preparation of porcine reproductive and respiratory syndrome virus detection kit

[0081] 1. Synthesis of primers

[0082] Same as Step 1 of Example 1.

[0083] 2. Preparation of LAMP reaction solution

[0084] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , Tween20 0.025μL, 10μmol MgSO 4 , 20 μmol betaine (Betaine), four deoxynucleotides (dNTPs) each 0.035umol, 0.05 μmol upstream inner primer (FIP), 0.05 μmol downstream inner primer (BIP), 0.006 μmol upstream outer primer (F3), 0.006 μmol Downstream outer primer (B3), 0.03 μmol upstream circular primer (LF), 0.03 μmol downstream circular primer (LB), 16 U of Bst DNA polymerase, 0.2 U of AMV reverse transcriptase, sterile double distilled water.

[0085] 3. Assembly of kit

[0086] Same as Step 3 of Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a porcine reproductive and respiratory syndrome virus detecting kit and applications thereof. The kit comprises three pairs of primers, namely an inner side primer pair, an outer side primer pair and an annular primer pair which are combined with MN genes in the porcine reproductive and respiratory syndrome virus Gen Bank Accession Number U87392. The kit also comprises a loop-mediated isothermal amplification reagent, positive contrast, negative contrast and a fluorescent chromogenic agent, and the positive contrast serves as the porcine reproductive and respiratory syndrome virus RNA. The invention also provides a method for detecting whether porcine reproductive and respiratory syndrome virus is carried in dead animals or not by utilizing the detecting kit. The invention has the advantages that the detecting sensitivity is high, the target RNA can be detected through 6 to 10 copies, and the operation is simple and convenient, thereby being particularly suitable for the clinical medicine detection conducted in the basal sites as well as the detection of the possibly polluted porcine reproductive and respiratory syndrome virus in food.

Description

technical field [0001] The invention relates to a porcine reproductive and respiratory syndrome virus detection kit and application thereof. Background technique [0002] Porcine reproductive and respiratory syndrome is caused by porcine reproductive and respiratory syndrome virus. It is an infectious disease with severe reproductive disorders such as abortion, premature birth and stillbirth in pregnant sows, and respiratory diseases in piglets and fattening pigs. The disease was first reported in the United States in 1987, and has also been reported successively in Canada, Germany, Spain, and the United Kingdom. In 1995, the disease was discovered in mainland my country and became popular in many provinces. Subsequently, the source of the disease was isolated from suspected cases in 1996 and 1997. Porcine reproductive and respiratory syndrome virus has become one of the important reasons that endanger pig production in my country. In addition, the contamination of porcin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 吴文学张跃伟李旭妮李佳禾
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com