Method of producing sialylated oligosaccharides

A technology of oligosaccharides and lactose, applied in the direction of oxidoreductase, transferase, fermentation, etc., can solve the problems that cannot be used in biotechnology processes, high cost of sialic acid, hindering the development of sialooligosaccharides, etc.

Active Publication Date: 2009-04-22
CENT NAT DE LA RECH SCI (C N R S)
View PDF9 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Despite these improvements, the cost of sialic acid is still relatively high, and this cost has hindered the development of more economical systems for the production of sialooligosaccharides.
[0007] Meanwhile, strains like E.coli K1 and N. meningitidis are also capable of producing CMP-Neu5Ac, but they are pathogenic and cannot be used in biotechnological processes for safety reasons.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of producing sialylated oligosaccharides
  • Method of producing sialylated oligosaccharides
  • Method of producing sialylated oligosaccharides

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0102] Production of 3' sialyllactose

[0103] The production of 3' sialyllactose can be achieved by a metabolically engineered strain as defined above expressing an enzyme encoding an α-2,3 sialyltransferase activity, such as α-2,3 sialyltransferase using lactose as an acceptor. Genes for acid transferase or bifunctional alpha-2,3 and alpha-2,8 sialyltransferase. As indicated, this strain lacks sialic acid aldolase, ManNAc kinase, and β-galactosidase activities, and expresses genes encoding CMP-Neu5Ac synthetase, a sialic acid synthase, a GlcNAc-6-phosphate 2 differential A heterologous gene for isomerase. For large-scale production of sialyllactose, this strain can be grown at high cell densities on inexpensive substrates such as glucose or glycerol and fed on lactose, which is internalized by lactose permease and used by recombinant sialyltransferases From such as figure 1 Sialylation of exogenously produced CMP-Neu5Ac in UDP-GlcNAc shown.

[0104] Production of 6' sial...

Embodiment 1

[0141] Example 1: Construction of nanA, nanKA and nanKETA mutants

[0142] All mutants were constructed from the DC strain (Dumon et al. 2005), a derivative of the DH1 strain carrying the lacZ and lacA mutations. Because all DH1 strain derivatives are recA mutated, they were transformed with the low-copy plasmid pEXT22 carrying a functional recA gene and kanamycin resistance, reverting to transient RecA by a gene inactivation program involving DNA recombination + Phenotype. Once the gene has been disrupted, the plasmid can be restored by growing the cells without kanamycin and selecting for the RecA-phenotype.

[0143] The AZL strain was constructed as a sub-DC strain by inactivating the nanA gene using the suicide plasmid pMAK705 (Hamilton et al. 1989), as previously described (Priem et al., 2002).

[0144] To construct ZLKA from DC strains, the nanKETA gene was disrupted by removing a 3.339 kb fragment in chromosomal DNA using a previously described one-step procedure usin...

Embodiment 2

[0148] Embodiment 2: Cloning of neuBCA gene

[0149] A 2.995 (kb) DNA fragment containing the neuBCA gene sequence was amplified by PCR using Campylobacter jejuni strain ATCC 43438 as a template.

[0150] A KpnI site was added to the left primer: 5'GGTACCTAAGGAGGAAAATAAATGAAAGAAATAAAAATACAA (SEQ ID NO 14)

[0151] Add an XhoI site to the right primer

[0152] 5'CTCGAGTTAAGTCTCTAATCGATTGTTTTTCCAATG (SEQ ID No 15).

[0153] The amplified fragment was first cloned into the pCR4Blunt-TOPO vector (Invitrogen) and then subcloned into the KpnI and XhoI sites of the pBBR1-MCS3 vector to form pBBR3-SS.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a method for the large scale in vivo synthesis of sialylated oligosaccharides, culturing a microorganism in a culture medium, optionally comprising an exogenous precursor such as lactose, wherein said microorganism comprises heterologous genes encoding a CMP-Neu5Ac synthetase, a sialic acid synthase, a GlcNAc-6-phosphate 2 epimerase and a sialyltransferase, and wherein the endogenous genes coding for sialic acid aldolase (NanA) and for ManNac kinase (NanK) have been deleted or inactivated. The invention also relates to these micoorganisms which are capable of producing internally activated sialic acid.

Description

technical field [0001] The present invention relates to a large-scale method for synthesizing sialylated oligosaccharides in vivo: a culture medium is used to cultivate a microorganism, optionally comprising an exogenous precursor such as lactose, wherein said microorganism comprises the enzyme encoding CMP-Neu5Ac synthetase, Heterologous genes for sialic acid synthase, GlcNAc-6-phosphate 2 epimerase, and sialyltransferase, wherein the endogenous genes encoding sialic acid aldolase and ManNac kinase (NanK) were knocked out or inactivated. The present invention also relates to such microorganisms, which can produce internally activated sialic acid. Background technique [0002] N-acetylneuraminic acid (Neu5Ac) is the most common member of the sialic acid family of amino sugars. Neu5Ac is often found as a terminal sugar in carbohydrate complexes on the cell surface and plays an important role in many biological processes such as cell adhesion and binding of toxins and viruses...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P19/18C12N9/04C12P19/26C12N9/10C12N1/21C12N9/12
CPCC12P19/26C12P19/18
InventorE·萨满
OwnerCENT NAT DE LA RECH SCI (C N R S)