Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method and special kit for detecting gene multi-mutant site

A technology of mutation sites and kits, which is applied in biochemical equipment and methods, and the determination/inspection of microorganisms, to achieve the effects of simple instrument requirements, avoiding pollution, and increasing specificity

Active Publication Date: 2009-12-09
CAPITALBIO CORP +1
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, only the PCR technology for detecting a single mutation site related to deafness is disclosed, and there is an urgent need for a PCR detection method that can detect two mutation sites related to deafness at the same time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and special kit for detecting gene multi-mutant site
  • Method and special kit for detecting gene multi-mutant site
  • Method and special kit for detecting gene multi-mutant site

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1, Detection of Multiple Mutation Sites in Human Mitochondrial 12S rRNA Gene

[0032] 1. Primer design:

[0033] Primer 5.0 software was used to design primers for the 1555 and 1494 mutation sites, the mutation sites were located at the 3′ end of the primers, and the two shared a downstream primer. The Tm value of the amplified product of 1555 was designed to be 77.1°C, and the Tm value of the amplified product of 1494 was 80.1°C.

[0034] In order to enhance the specificity of the reaction, artificially mutated bases were introduced into the penultimate base of the 3' end of primers 1555 and 1494. The primer sequences are as follows:

[0035] Primer at position 1555: 5' CCCTACGCATTTATATAGAGGCGG 3' (SEQ ID NO: 1)

[0036] Primer at position 1494: 5'CACACCGCCCGTCTCT 3' (SEQ ID NO: 2)

[0037] Common downstream primer: 5' GCACTTTCCAGTACACTTACCA 3' (SEQ ID NO: 3)

[0038] For a conserved nucleic acid segment on the mitochondria, internal standard primers were ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting gene multi-mutant site and a special kit thereof. The method for detecting the gene multi-mutant site is a method for detecting the A-to-G mutation of a 1555 site and / or the C-to-T mutation of a 1494 site of a 12S rRNA gene of plastosome, three primers are adopted, and the sequences of the three primers are respectively a sequence 1, a sequence 2 and a sequence 3 in a sequence table. The method comprises the following steps: PCR amplification is carried out by using the three primers; the melting curve of a PCR amplification product is detected; if a melting peak with the melting temperature of 79.4 DEG C appears, point mutation exists at the 1555 site of the 12S rRNA gene of the human plastomsome, and the mutant type is A to G; if a melting peak with the melting temperature of 76.6 DEG C appears, point mutation exists at the 1494 site of the 12S rRNA gene of the human plastomsome, and the mutant type is C to T. The invention also discloses a special kit for detecting the gene multi-mutant site.

Description

technical field [0001] The invention relates to a method for detecting multiple gene mutation sites and a special kit thereof. Background technique [0002] Base mutation is a very important type of mutation in the human genome. Many base mutations are closely related to the occurrence of diseases. Therefore, the detection of mutation information at certain sites is of great importance for the clinical diagnosis of diseases and the guidance of clinical treatment. significance. [0003] Aminoglycoside antibiotics include gentamicin, streptomycin, kanamycin, tobramycin, etc., because they are particularly effective against Gram-negative bacteria, and they are also effective against some Gram-positive bacteria. Synergistic antibacterial effect. Therefore, it is widely used in clinical treatment. However, these drugs have serious ototoxic side effects and may cause irreversible damage to hearing when used. [0004] Mitochondrial 12S rRNA gene is a mutational hotspot in amino...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 王思贤高华方侯伟程京
Owner CAPITALBIO CORP
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More