42results about How to "Instrument requirements are simple" patented technology

The invention relates to the technical field of edible oil, and provides a method for detecting the adulterated tea oil. The method comprises the following steps of: firstly, establishing a refractive index, an iodine value, a saponification value and an oleic acid content adulteration detection model, determining the adulteration type by detecting the sample, then, determining an adulteration quantity model through ultraviolet spectrum full-wave scanning, and comparing the data to obtain the determined adulteration quantity. According to the method provided by the invention, not only can the adulteration type for the tea oil be identified, but also the adulteration quantity can be detected, so that cheap edible oil can be prevented from being used for personating expensive tea oil. The method provided by the invention has the characteristics of being economical and simple, excellent in repeatability and high in accuracy, and the like, can be practically used for the teal oil adulteration detection work, and can guarantee and safeguard the benefits of consumers.

The invention discloses an exosome nucleic acid detection technology based on magnetism-enriched electrochemical luminescence. The exosome nucleic acid detection technology comprises the steps of sample pretreatment and separation of an exosome standard substance, activation of streptavidin magnetic beads and a biotin antibody, binding of immunomagnetic magnetic beads and an exosome, preparation of exosome nucleic acid sample preparation and target nucleotide sequence detection through electrochemical luminescence. The exosome nucleic acid detection technology has the advantages that exosomesin biological samples such as urine, serum, saliva and a cell culture fluid can be separated and analyzed; antibodies are modified to the surfaces of the magnetic beads through specific binding of biotin and streptavidin, systems are stable, and nonspecific interference is avoided; the systems are controllable, different subtypes of exosomes are separated and purified by changing antibody types, and the technology can be used for nucleic acid expression profile studies and exosome somatotype studies; the final concentration is controllable, required concentration is obtained through re-dilution or re-releasing after magnetic enrichment, and follow-up detection is facilitated; the separation speed is high, the instrument requirement is low, and multiple samples can be treated simultaneously.

The invention discloses a method for identifying Mycobacterium tuberculosis and nontuberculosis mycobacteria and a special reagent kit thereof. The reagent kit for identifying the Mycobacterium tuberculosis and the nontuberculosis mycobacteria comprises a primer and a probe, wherein the primer comprises four primers, and ribonucleotide sequences of the four primers are sequence 1, sequence 2, sequence 4, and sequence 5 in a sequence table respectively; the probe comprises two probes, and ribonucleotide sequences of the two probes are sequence 3 and sequence 6 in the sequence table respectively; 5' ends of the probes are provided with fluorescent substances, and 3' ends of the probes are provided with quenching substances; and the fluorescent substances at the 5' ends of the two probes aredifferent. The reagent kit has the advantages that the reagent kit can quickly identify the Mycobacterium tuberculosis and the nontuberculosis mycobacteria, has simple requirement on instruments, lowcost and simple operation, and has broad application prospect on early diagnosis and differential diagnosis of tuberculosis.

The invention discloses a method for measuring an edible oleic acid value based on conductivity, which utilizes a conductivity meter as a detection tool. The method comprises the following steps: when in measurement, fully mixing alkali liquor having a certain low concentration with an oil sample according to a certain mixing proportion; standing for delamination; and then measuring the conductivity of the alkali liquor layer, and predicting the edible oleic acid value through the change of the conductivity of the alkali liquor layer and by using a model. The measuring step is divided into modeling, model verifying, blind sample verifying, model predicting application and the like. The method has simple application without poisonous organic solvents. An oil-alkali mixing proportion can be regulated according to the practical detection requirements so as to meet different acid value measuring scopes and different precision requirements. The method is a novel method for measuring the edible oleic acid value.

The invention relates to a method for detecting activity of catalase, belonging to the field of enzymatic activity detection methods. The method for detecting activity of catalase comprises the following steps: diluting a catalase standard substance into a standard solution with a series of catalase activity concentrations, adding 10mL of chlorine peroxide phosphate buffer solution in a 100mL iodine measuring flask, putting the iodine measuring flask in water bath at 25 DEG C and carrying out heat preservation, then adding 2mL of a standard enzyme solution, accurately carrying out heat preservation for 3 minutes, instantly adding 2mL of 0.5mol / L sulfuric acid to end reaction, adding 2mL of 0.5mol / L sulfuric acid into a contrast tube of a contrast reaction solution to end reaction, and then adding the enzyme solution; then extracting 0.1mL of the reaction solution, adding 2.9mL of a peroxidase-dianisidine solution in a test tube and shaking to be uniform, firstly carrying out zero adjustment by a blank test tube in 436microns by virtue of a spectrophotometer at 25 DEG C, then detecting absorbancy of each reaction solution test tube to obtain a curve about the relation between the standard enzymatic activity and the absorbancy. The test enzyme is processed by the same method, so that the enzymatic activity of the test enzyme can be obtained according to the absorbancy and the standard curve. The detection method has the characteristics of being accurate, high in practicability, simple in instrument requirement and suitable for operation in the conventional condition; the detection method belongs to one reliable method of color rendering methods for detecting the activity of the catalase.

The invention discloses a method for determining oil content of vegetable oil material. The method utilizes an ultrasonic wave as an assistant tool, and comprises the steps of sampling, sample preparation, solvent ultrasonic assistant extraction, solvent recovery, extract drying, oil content calculation and the like. The method can completely and quickly extract and determine crude fat in the vegetable oil material, and can greatly speed up the process of extracting the crude fat in the oil material so as to shorten the determination time of the vegetable oil material. Compared with the conventional Soxhlet extraction method, the method has the advantages of simple operation, short consumed time, accurate determination result, good repeatability and the like, and is a novel method for quickly determining the oil content of the vegetable oil material.

The invention relates to a method for fast identifying the meadow type high fescue heat-proof quality in the field of cool quaternary type meadow resistance identifying biology technology. It puts the best seed of the meadow type high fescue species in the basin with the sand, clay and nutritious soil (the volume ratio is 1:3:3), and breeds it for 18 days at normal temperature, wherein part plant moves to the artificial climate case with the temperature of 35í‚0.5 deg. in daytime and the temperature of 30í‚0.5 deg. in dark time with the optical photon 150-200ª–molm-2 s-1 and the percentage humidity 65-70úÑ for three days. It adds non-nutrients during the breeding course. It separately collects the meadow type high fescue health leaf at normal temperature and the high temperature and measures the chlorophyll a and b content of unit weight of the leaf tissue.

The invention discloses establishment of a reverse transcription loop-mediated isothermal amplification (RT-LAMP) detection method for Prunus necrotic ringspot virus (PNRSV). According to the RT-LAMP detection method for the PNRSV, four specific primers are designed for six regions of a target gene PNRSV, a type of strand displacement deoxyribonucleic acid (DNA) polymerase is utilized at the constant temperature of around 65 DEG C, and efficient amplification of nucleic acids can be achieved in dozens of minutes. The four specific primers are used for identifying the six specific sequence regions of a target sequence, and therefore high specificity of amplification of LAMP is guaranteed. In the process of LAMP, thermal denaturation of template is not needed, temperature is cycled for a long time, the amplification is carried out under isothermal conditions, a waste of time due to temperature change is not caused, and the reaction speed can be increased by 30-50%. Based on whether visible white precipitate of magnesium pyrophosphate exists in a reaction tube, whether the nucleic acids are amplified can be easily judged. The RT-LAMP method for detection of the PNRSV is high in specificity, and the RT-LAMP method for detection of the PNRSV has the advantages of being rapid, high in efficiency, simple in instrument requirement, simple and convenient to operate, low in cost and easy to popularize and use at the grass-roots.

The invention discloses a method for determining activity of terminal deoxynucleotidyl transferase (TdT) and application of the method. The method comprises the steps of: (1) designing a single-stranded DNA as a DNA probe; (2) incubating TdT with different final concentrations with DNA probes, CoCl2, dTTPs and a buffer solution separately to obtain a single-stranded probe DNA solution rich in a poly-T sequence; then adding a mercury salt to incubate to obtain a T-HgII-T structure-mediated double-stranded DNA solution; adding a nucleic acid dye to obtain a mixed solution; and finally detectinga fluorescence intensity signal of the mixed solution, and drawing a detection curve according to the fluorescence intensity signal and the final concentration of TdT; and (5) replacing the TdT with asample to be tested, repeating the above steps, and then comparing the detection result with the detection curve to calculate the content of TdT in the sample to be tested. The method has high sensitivity and good selectivity, and provides a new means for medical detection and biological research.

The invention discloses an LAMP (loop-mediated isothermal amplification) detection kit for fish pathogen pseudomonad plecoglossicida and a detection method thereof. The LAMP detection kit is characterized by comprising 10*ThermlPol reaction buffers, a MgSo4 MgSO4 (magnesium sulfate) solution with concentration of 100mM, a dNTP (deoxy-ribonucleoside triphosphate) solution with concentration of 10mM, a lycine solution with concentration of 5M, a Bst (bacillus stearothermophilus) DNA (deoxyribonucleic acid) polymerase solution with concentration of 8U / muL, an FIP / BIP (forward inner primer / backward inner primer) solution, an F3 / B3 (forward outer primer / backward outer primer) solution and double distilled water, wherein the sequence of the FIP primer solution is shown as SEQIDNO. 1, the sequence of the BIP primer solution is shown as SEQIDNO. 2, the sequence of the F3 primer is shown as SEQIDNO. 3, and the sequence of the B3 primer is shown as SEQIDNO. 4. The LAMP detection kit has the advantages that the sensitivity is high and the specificity is high, and the LAMP detection kit is suitable for quickly detecting the pseudomonad plecoglossicida of large yellow croaker in a seawater farm.

The invention provides a loop-mediated isothermal amplification (LAMP) detection method for babesia bovis. The method comprises the following steps of: extracting deoxyribose nucleic acid (DNA) of a specimen to be detected; setting an LAMP detection kit; performing LAMP amplification; analyzing amplification products; and determining by comparing color change of the specimen to be detected, a positive control and a negative control. The method can conveniently, quickly and accurately detect the babesia bovis in the specimen to be detected, and can be used for surveying molecular epidemiology of the babesia bovis and monitoring treatment effects. By the detection method, a template is easy to prepare, the cost is low, and the specificity and sensitivity can be improved. The result can be observed by naked eyes by adding an appropriate amount of SYBR GREEN I dyes, the instrument requirement is low, the consumed time is short, the result judgment is simple, the specificity and the sensitivity are high, the requirements of clinical detection can be met, and the prospect is wide.

The invention discloses a corynespora cassiicola succinodehydrogenase subunit c N75S resistance mutation detection primer and a detection method and belongs to the technical field of resistance mutation detection. The primer comprises 2 outer primers and 2 inner primers, and nucleotide sequences of the 2 outer primers and the 2 inner primers are shown as SEQ ID No. (sequence identifier number) 1,SEQ ID No. 2, SEQ ID No. 5 and SEQ ID No. 4. The four primers identify 6 specific sequence regions of a target sequence, and high specificity of LAMP (loop-mediated isothermal amplification) is ensured. The detection method comprises the steps of extracting DNA (deoxyribonucleic acid) of a sample for LAMP reaction, performing electrophoresis on a reaction product or adding a fluorescent dye for direct observation to achieve quick detection of subunit c N75S resistance mutation. The method has strong detection specificity for the N75S mutation on a subunit c, has the characteristics of simplicity, convenience, quickness, sensitiveness and stability, and is low in instrument requirements, easy and simple to operate, low in cost and easy to popularize and use at the grass-roots.

The invention discloses a fluorescence chemical method for detecting ALP (Alkaline Phosphatase) and application thereof. The fluorescence chemical method comprises the following steps of: firstly, designing a single-chain DNA (Deoxyribonucleic Acid) of which a 3' terminal is phosphorylated as a DNA probe, dephosphorylating the 3' terminal of the DNA probe and exposing a 3'-OH terminal when the ALPexists; secondly, performing catalytic addition on dTTPs (Deoxythymidine Triphosphates) at a 3'-OH terminal of the DNA probe by TdT (Terminal Deoxynucleotidyl Transferase), thus extending to generatea poly-T tail ssDNA, forming a dual-chain DNA mediated by T-HgII-T structure by the poly-T tail ssDNA and Hg ions, and drawing a detecting curve according to a detected fluorescence intensity signaland the concentration of the ALP after adding nucleic acid dye; finally, replacing the ALP with a to-be-detected sample, repeating the steps, and comparing a detecting result with the detecting curve,thus calculating the content of the ALP in the sample. The fluorescence chemical method disclosed by the invention is simple and convenient, is high in sensitivity and can be used for detecting the ALP or screening ALP inhibitors.

The invention discloses a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) detection reagent and a kit of Equine Arteritis virus. The RT-LAMP detection reagent comprises: an F3 primer solution with nucleotide sequences GCCTCGTCTTCGGTCCAT, a B3 primer solution with nucleotide sequences CGCCCGTTTCGAAAAGAGG, a BIP primer solution with nucleotide sequences TTGAGCGGGGGATGGGAACACATCGCCAACTGGTGGTAG, and an FIP primer solution with nucleotide sequences ACTCAGATAGTGGTTCGCGGCGTCTTGACGCCATCGACAAG. The kit contains: a 10 x ThermoPol buffer solution, dNTP, BstDNA polymerase, betaine and MgCl2. The RT-LAMP detection reagent and the kit have advantages of high sensitivity, high specificity, simpleness and convenience in operation, simple requirement for instruments, and easily observed detection result and is suitable for on-site rapid detection of the Equine Arteritis virus. The invention also provides the technical support for early prevention and treatment of the Equine Arteritis virus.

The invention discloses an LAMP (Lysosomal Associated Membrane Protein) detection kit and a detection method of the LAMP detection kit. The LAMP detection kit comprises a reaction buffer, a MgSO4 solution, a dNTP (deoxy-Ribonucleoside Triphosphate) solution, BstDNA (BstDeoxyribonucleic Acid) polymerase solution, an FIP (Forward Inner Primer) / BIP (Backward Inner Primer) solution, an F3 / B3 primer solution and double distilled water. The LAMP detection kit has high sensitivity and high specificity for the cryptocaryon irritans of the large yellow croaker and is suitable for quick field detection for cryptocaryon irritans disease of the large yellow croaker in a marine park; and the LAMP detection kit for detecting the cryptocaryon irritans of the large yellow croaker has the advantages of simpleness in operation, simpleness for requirement on instruments, easy observation for result and the like and provides technical support for early control over the cryptocaryon irritans disease.

The invention discloses a high-flux photo-thermal preparation method and application of a defect-adjustable metal oxide. The method comprises the following steps: putting a metal oxide into a mixed solution of deionized water and glycerol, and carrying out vacuum treatment and ultraviolet-visible-infrared light full-spectrum irradiation to obtain the metal oxide with adjustable and controllable defect (Ti<3+> and oxygen vacancy) content by adjusting the condensation ratio or illumination time. The metal oxide is one of titanium dioxide, copper oxide, zinc oxide, strontium titanate, tungsten trioxide, cerium oxide and indium trioxide. Compared with a traditional method for generating defects by high-temperature calcination in a reducing atmosphere, the method provided by the invention is simple to operate, green and environment-friendly, low in cost and wide in application range. The defect-adjustable metal oxide prepared by the method can be optimized to obtain high photocatalytic performance by changing the electronic structure and chemical characteristics of a catalyst, and can be applied to the fields of full-spectrum solar water splitting hydrogen production, carbon dioxide reduction and atmosphere and water pollutant treatment.

The invention discloses a tumor cell proliferation detection method based on Hochest333258 and application. The method comprises the following steps: subculturing tumor cells to a cell culture plate,counting cells, then carrying out doubling dilution, so that a gradient series with different cell numbers is obtained, carrying out the conventional culture in a culture medium, then adding liquid containing Hochest333258, uniformly mixing, then standing for a period of time, abandoning a cell culture medium, washing off residual culture medium with PBS buffer liquid, then adding the PBS buffer liquid, finally detecting a fluorescent value, and judging cell proliferation level or survival rate by virtue of fluorescence signal intensity. The method disclosed by the invention is simple and is high in repeatability and accuracy; and the proliferation level of the tumor cells can be effectively detected.

The invention discloses a half antigen SPE-EDE and a corresponding artificial antigen and application of the half antigen. A protection formula (I) shows a compound. A method that a compound is shown in a preparation formula (I) is provided, and the method comprises the following steps: spectinomycin hydrochloride is made to react with ethylene glycol bis(2,3-epoxypropyl) ether, and the compound shown in the formula (I) is generated; the compound shown in the formula (I) and conjugate (the artificial antigen) of carrier protein are further provided. The antibody obtained by serving the any conjugate as the immunogen is provided. The invention further provides a kit. The kit comprises the conjugate and the antibody. The invention further provides any conjugate or the antibody or the application of the knit to detection of spectinomycin or spectinomycin derivatives (like spectinomycin hydrochloride). The application has the great practical value in detection of the spectinomycin and the spectinomycin derivatives, operation is easy, the cost is low, and the requirement of a detection limit can be met. The formula (I) is shown in the description.

The invention discloses a method for determining trace Co (II) in drinking water. The method includes the steps that a series of standard working solutions of the Co (II) are prepared, a main pump collects a Co (II) standard solution or a sample solution R1 to be measured and a buffer solution R2, a reagent R1 enters a chemical block directly, and the buffer solution R2 and a colorimetric solution R3 collected by an auxiliary pump enter a multi-channel sampling valve and also enter the chemical block after being mixed; then, the Co (II) standard solution or the sample solution R1 to be measured, the buffer solution R2 and the colorimetric solution R3 enter a 2 m reaction coil tube, the Co (II) reacts with salicyl fluorone under the existence of CPB, a solution obtained after the reaction enters a spectrophotometer, the light absorption signal value of the reaction system is obtained, and the concentration of the Co (II) is quantitatively calculated according to the peak height; waste liquid is discharged into a special waste liquid collection bottle to be treated, the sample injection process is executed again, another time of analysis begins, and therefore continuous determination analysis is achieved. The method is used for determining the Co (II) in the drinking water, and the recovery rate is 97%-104.3%.

The invention relates to the technical field of edible oil, and provides a method for detecting the adulterated tea oil. The method comprises the following steps of: firstly, establishing a refractive index, an iodine value, a saponification value and an oleic acid content adulteration detection model, determining the adulteration type by detecting the sample, then, determining an adulteration quantity model through ultraviolet spectrum full-wave scanning, and comparing the data to obtain the determined adulteration quantity. According to the method provided by the invention, not only can the adulteration type for the tea oil be identified, but also the adulteration quantity can be detected, so that cheap edible oil can be prevented from being used for personating expensive tea oil. The method provided by the invention has the characteristics of being economical and simple, excellent in repeatability and high in accuracy, and the like, can be practically used for the teal oil adulteration detection work, and can guarantee and safeguard the benefits of consumers.

The invention discloses a method for identifying Mycobacterium tuberculosis and nontuberculosis mycobacteria and a special reagent kit thereof. The reagent kit for identifying the Mycobacterium tuberculosis and the nontuberculosis mycobacteria comprises a primer and a probe, wherein the primer comprises four primers, and ribonucleotide sequences of the four primers are sequence 1, sequence 2, sequence 4, and sequence 5 in a sequence table respectively; the probe comprises two probes, and ribonucleotide sequences of the two probes are sequence 3 and sequence 6 in the sequence table respectively; 5' ends of the probes are provided with fluorescent substances, and 3' ends of the probes are provided with quenching substances; and the fluorescent substances at the 5' ends of the two probes are different. The reagent kit has the advantages that the reagent kit can quickly identify the Mycobacterium tuberculosis and the nontuberculosis mycobacteria, has simple requirement on instruments, low cost and simple operation, and has broad application prospect on early diagnosis and differential diagnosis of tuberculosis.