Reverse transcription-loop-mediated isothermal amplification(RT-LAMP) detection reagent and kit of Equine Arteritis virus

A technology of RT-LAMP and equine arteritis virus, which is applied in the detection field of equine arteritis virus, can solve the problems of cumbersome operation, low specificity, and high requirements for instruments, and achieve simple instrument requirements, simple and convenient operation, and high sensitivity Effect

Inactive Publication Date: 2012-07-25
NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, EVA detection methods mainly include virus neutralization test, pathogen identification, complement fixation test, hemagglutination inhibition test, enzyme-linked immunosorbent assay (ELISA, ) and RT-PCR detection, among which virus neutralization test and pathogen identification (only (limited to semen) is an OIE international trade designated test method, and the authorized announcement number is the invention patent of CN1851463, which discloses the indirect enzyme-linked immunosorbent assay method for detecting EAV, RT-PCR detection such as Du Jian’s RT-PCR detection of equine arteritis virus The establishment of the method (China Animal Quarantine, 2005, (5): 30-32); but the above-mentioned methods have different disadvantages, for example, the required test period is long, the requirements for instruments are high, the operation is cumbersome, and on-site detection is not possible. And the sensitivity is not high, the specificity is not strong, the accuracy is low, and it is easy to be limited by the detection material, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0011] Example 1. Primer design, screening and synthesis: the conserved fragment of the M gene of the equine arteritis virus membrane protein (GENBANK, accession number DQ846750) was selected as the target, and PrimerExploer V4 software (http: / / primerexplorer.jp / elamp4. 0.0 / index.html) analysis, design and synthesis; the optimal pairing screening experiment (specificity and sensitivity test) of multiple sets of synthesized internal and external primers, the most suitable nucleotide sequence is: F3 primer of GCCTCGTCTT CGGTCCAT, core The nucleotide sequence is: B3 primer of CGCCCGTTTC GAAAAGAGG, the nucleotide sequence is: TTGAGCGGGG GATGGGAACA CATCGCCAAC TGGTGGTAG, and the nucleotide sequence is: ACTCAGATAG TGGTTCGCGG CGTCTTGACG CCATCGACAA G FIP primer.

Embodiment 2

[0012] Example 2, RT-LAMP detection reagents and kits: the above-mentioned F3 primers, B3 primers, BIP primers and FIP primers were prepared respectively to prepare F3 primer solutions, B3 primer solutions, BIP primer solutions and FIP primer solutions with a primer concentration of 10 μM and a kit to form a 100×25 μl reaction system: 2.5 μl of 10×ThermoPol buffer, 1 μl of Bst DNA polymerase at a concentration of 8 U / μL, 2 μl of dNTP at a concentration of 2.5 mM, 2 μl of betaine at a concentration of 5 M, 25 mM MgCl 2 1 μl, 0.5 μl each of F3 primer solution and B3 primer solution with a concentration of 10 μM, and 4 μl each of BIP primer solution and FIP primer solution with a concentration of 10 μM.

Embodiment 3

[0013] Example 3. Specificity test: The nucleic acids of equine arteritis virus, porcine pseudorabies virus, porcine reproductive and respiratory syndrome virus, and Akabane disease virus were respectively extracted with QIAGEN nucleic acid extraction kit. Then use the cDNA synthesis kit (purchased from Dalian Baosheng Biology) to transcribe the extracted nucleic acid: 5×AMV Buffer 4μL, 2.5mM dNTP Mixture 5μL, 20μM 9N random primer 1μL, RNase Inhibitor 0.5μL, AMV Rtase 1μL, extracted RNA Nucleic acid 1 μL, DEPC-treated H 2 Make up 20 μL of O; mix the reaction solution gently, place it at room temperature for 10 min, keep it in a water bath at 42 °C for 1 hour, and then put the reaction tube in ice to cool for 2 min. The resulting product is a cDNA template and stored at -20 °C. Then use the RT-LAMP detection reagent and kit in Example 2 to form a 25 μl reaction system: 2.5 μl of 10×ThermoPol buffer, 1 μl of Bst DNA polymerase with a concentration of 8 U / μL, 2 μl of dNTP with a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) detection reagent and a kit of Equine Arteritis virus. The RT-LAMP detection reagent comprises: an F3 primer solution with nucleotide sequences GCCTCGTCTTCGGTCCAT, a B3 primer solution with nucleotide sequences CGCCCGTTTCGAAAAGAGG, a BIP primer solution with nucleotide sequences TTGAGCGGGGGATGGGAACACATCGCCAACTGGTGGTAG, and an FIP primer solution with nucleotide sequences ACTCAGATAGTGGTTCGCGGCGTCTTGACGCCATCGACAAG. The kit contains: a 10 x ThermoPol buffer solution, dNTP, BstDNA polymerase, betaine and MgCl2. The RT-LAMP detection reagent and the kit have advantages of high sensitivity, high specificity, simpleness and convenience in operation, simple requirement for instruments, and easily observed detection result and is suitable for on-site rapid detection of the Equine Arteritis virus. The invention also provides the technical support for early prevention and treatment of the Equine Arteritis virus.

Description

technical field [0001] The invention relates to a detection technology for equine arteritis virus, in particular to an RT-LAMP detection reagent and kit for equine arteritis virus. Background technique [0002] Equine viral arteritis is an infectious disease caused by equine arteritis virus (Equine viral arteritis, EVA) transmitted through the respiratory tract or reproductive organs. It is one of the major diseases that endanger the horse industry. ) into the quarantine list. Equine arteritis virus (EAV) belongs to the order Nidovirale, Arteriviridae, Arterivirus, it is a linear single-stranded positive-sense RNA virus containing at least 9 Overlapping open reading frames encoding seven structural proteins: small envelope proteins (E, GP2b, GP3, and GP4), nucleocapsid proteins (N), membrane matrix proteins (M), and major envelope proteins GP5. 1957 Doll The virus was isolated for the first time in Bucyrus, Ohio, USA, and is currently distributed all over the world. Most o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 黄素文于纪棉郭巍戚亭王建峰倪健波杨文潮李如松张超章胜乔相文华
Owner NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap