Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

LAMP (loop-mediated isothermal amplification) detection kit for fish pathogen pseudomonad plecoglossicida and detection method

A technology of Pseudomonas ayumi and a detection kit, which is applied in the direction of microorganism-based methods, microorganism measurement/inspection, biochemical equipment and methods, and can solve the problems of lack of sensitivity and specificity, inability to distinguish, and inability to meet On-site and grassroots inspections and other issues, to achieve high sensitivity, easy results, and high specificity

Inactive Publication Date: 2014-04-23
NINGBO UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these traditional detection methods cannot distinguish Pseudomonas ayumi from other bacteria in the Pseudomonas genus, such as Pseudomonas putida, etc., lacking sensitivity and specificity
Polymerase chain reaction (PCR) has extremely high sensitivity and specificity, and has been widely used in the practice of diagnosing pathogenic bacteria, but it requires the use of many precision instruments such as PCR machines, making it unable to meet the needs of on-site and grassroots inspections. needs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (loop-mediated isothermal amplification) detection kit for fish pathogen pseudomonad plecoglossicida and detection method
  • LAMP (loop-mediated isothermal amplification) detection kit for fish pathogen pseudomonad plecoglossicida and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] A LAMP detection kit for fish pathogenic bacteria Pseudomonas ayumi, including 250 μL of 10× ThermoPol reaction buffer and MgSO at a concentration of 100 mM 4 50 μL solution, 300 μL dNTP solution with a concentration of 10 mM, 100 μL Bst DNA polymerase solution with a concentration of 8 U / μL, 400 μL Betaine solution with a concentration of 5 M, 50 μL FIP / BIP primer solution with a primer concentration of 1.6-2.4 μM, 50 μL of F3 / B3 primer solution with a concentration of 0.4-0.6 μM, and make up the rest with double distilled water. The nucleotide sequence of the FIP primer is GCGTTCTTGCTGGCGCAGGTCGATGTACTGGTCGAGCGT, the nucleotide sequence of the BIP primer is TGCCGCGTGCCGACTTTTGGCCAGGTCACCGG, and the nucleotide sequence of the F3 primer It is AAGTGCAAGT CATCAGCT, the nucleotide sequence of B3 primer is GCAGCTGCCCACTTGGT, FIP primer, BIP primer, F3 primer and B3 primer are GENBANK, accession number JN688867 The conserved housekeeping gene rpoD gene specific fragment was a...

Embodiment 2

[0022] The detection method of this LAMP detection kit comprises the following steps:

[0023] (1) Take a piece of infected large yellow croaker soybean-sized visceral tissue, add 450 μl of TE buffer solution (pH 8.0, Tris-HCl concentration 10 mmol / L, EDTA concentration 1 mmol / L), and cut the tissue with medical scissors at the same time, room temperature 6000r / L Wash and centrifuge for 2 min, discard the supernatant, and then add 450 μl of the TE buffer, 3 μl of proteinase K solution with a concentration of 20 mg / mL, and sodium dodecyl sulfate (SDS) with a concentration of 20% by mass to the tissue 20 μl of the solution, mixed well, and warmed at 37°C for 30 minutes for the first time. After the first warming, add 100 μl of NaCl solution with a concentration of 5 mol / L, cetyltrimethylammonium bromide sodium chloride mixture (CTAB concentration 10%, NaCl concentration 0.7mol / L ) 80μl, mix well, and incubate again at 65°C for 10min to obtain bacterial body temperature bath;

[0...

Embodiment 3

[0027] Specificity and Sensitivity Tests

[0028] Fish pathogenic bacteria Pseudomonas ayumi were collected, and the common bacteria Vibrio harvei, Vibrio alginolyticus, Vibrio parahaemolyticus, Streptococcus iniae, Aeromonas hydrophila and Pseudomonas putida were cultured in seawater Etc. pathogenic bacteria is the specificity of specificity sample test LAMP reaction, carries out with the identical extraction of embodiment 2 and detection method, the DNA concentration of extracting Pseudomonas ayutii genomic DNA is recorded with the ultraviolet spectrophotometer of extraction, Using this as the mother solution, the DNA was diluted in a gradient, and 1.0 μl of each concentration was used as a template for LAMP amplification. The LAMP detection result shows that the Pseudomonas ayumi sample is positive, and the other samples are all negative, showing that there is no cross-reaction with other common pathogens in seawater culture, indicating that the kit of the present invention...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP (loop-mediated isothermal amplification) detection kit for fish pathogen pseudomonad plecoglossicida and a detection method thereof. The LAMP detection kit is characterized by comprising 10*ThermlPol reaction buffers, a MgSo4 MgSO4 (magnesium sulfate) solution with concentration of 100mM, a dNTP (deoxy-ribonucleoside triphosphate) solution with concentration of 10mM, a lycine solution with concentration of 5M, a Bst (bacillus stearothermophilus) DNA (deoxyribonucleic acid) polymerase solution with concentration of 8U / muL, an FIP / BIP (forward inner primer / backward inner primer) solution, an F3 / B3 (forward outer primer / backward outer primer) solution and double distilled water, wherein the sequence of the FIP primer solution is shown as SEQIDNO. 1, the sequence of the BIP primer solution is shown as SEQIDNO. 2, the sequence of the F3 primer is shown as SEQIDNO. 3, and the sequence of the B3 primer is shown as SEQIDNO. 4. The LAMP detection kit has the advantages that the sensitivity is high and the specificity is high, and the LAMP detection kit is suitable for quickly detecting the pseudomonad plecoglossicida of large yellow croaker in a seawater farm.

Description

technical field [0001] The invention relates to a detection technology for Pseudomonas ayumi, in particular to a LAMP detection kit and a detection method for fish pathogenic bacteria Pseudomonas ayumi. Background technique [0002] Pseudomonas plecoglossicida was originally isolated from the viscera of sweetfish suffering from hemorrhagic disease. In recent years, it was found that it can cause visceral granuloma in large yellow croaker in Zhejiang and Fujian. The pathogen can cause abnormal activity of large yellow croaker, visceral granuloma, tissue necrosis and other symptoms. For example, in March and November 2010, large-scale large yellow croaker pseudomonas disease broke out in Xiangshan, Ningbo. The epidemic covered large yellow croakers of various sizes. The mortality rate of yellow croaker is more than 60%, which brings huge economic losses to the local aquaculture industry. Therefore, it is particularly important to analyze and detect the pathogenic bacteria in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04C12R1/38
Inventor 王国良张继挺周涛
Owner NINGBO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com