LAMP (loop-mediated isothermal amplification) detection kit for fish pathogen pseudomonad plecoglossicida and detection method
A technology of Pseudomonas ayumi and detection kits, applied in the direction of microorganism-based methods, microorganism measurement/inspection, biochemical equipment and methods, etc., can solve the problem of inability to meet on-site and grassroots inspections, lack of sensitivity and specificity , can not be distinguished and other problems, to achieve the effect of easy results, high sensitivity and high specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] A LAMP detection kit for fish pathogenic bacteria Pseudomonas ayumi, including 250 μL of 10× ThermoPol reaction buffer and MgSO at a concentration of 100 mM 4 50 μL solution, 300 μL dNTP solution with a concentration of 10 mM, 100 μL Bst DNA polymerase solution with a concentration of 8 U / μL, 400 μL Betaine solution with a concentration of 5 M, 50 μL FIP / BIP primer solution with a primer concentration of 1.6-2.4 μM, 50 μL of F3 / B3 primer solution with a concentration of 0.4-0.6 μM, and make up the rest with double distilled water. The nucleotide sequence of the FIP primer is GCGTTCTTGCTGGCGCAGGTCGATGTACTGGTCGAGCGT, the nucleotide sequence of the BIP primer is TGCCGCGTGCCGACTTTTGGCCAGGTCACCGG, and the nucleotide sequence of the F3 primer It is AAGTGCAAGT CATCAGCT, the nucleotide sequence of B3 primer is GCAGCTGCCCACTTGGT, FIP primer, BIP primer, F3 primer and B3 primer are GENBANK, accession number JN688867 The conserved housekeeping gene rpoD gene specific fragment was a...
Embodiment 2
[0022] The detection method of this LAMP detection kit comprises the following steps:
[0023] (1) Take a piece of infected large yellow croaker soybean-sized visceral tissue, add 450 μl of TE buffer solution (pH 8.0, Tris-HCl concentration 10 mmol / L, EDTA concentration 1 mmol / L), and cut the tissue with medical scissors at the same time, room temperature 6000r / L Wash and centrifuge for 2 min, discard the supernatant, and then add 450 μl of the TE buffer, 3 μl of proteinase K solution with a concentration of 20 mg / mL, and sodium dodecyl sulfate (SDS) with a concentration of 20% by mass to the tissue 20 μl of the solution, mixed well, and warmed at 37°C for 30 minutes for the first time. After the first warming, add 100 μl of NaCl solution with a concentration of 5 mol / L, cetyltrimethylammonium bromide sodium chloride mixture (CTAB concentration 10%, NaCl concentration 0.7mol / L ) 80μl, mix well, and incubate again at 65°C for 10min to obtain bacterial body temperature bath;
[0...
Embodiment 3
[0027] Specificity and Sensitivity Tests
[0028] Fish pathogenic bacteria Pseudomonas ayumi were collected, and the common bacteria Vibrio harvei, Vibrio alginolyticus, Vibrio parahaemolyticus, Streptococcus iniae, Aeromonas hydrophila and Pseudomonas putida were cultured in seawater Etc. pathogenic bacteria is the specificity of specificity sample test LAMP reaction, carries out with the identical extraction of embodiment 2 and detection method, the DNA concentration of extracting Pseudomonas ayutii genomic DNA is recorded with the ultraviolet spectrophotometer of extraction, Using this as the mother solution, the DNA was diluted in a gradient, and 1.0 μl of each concentration was used as a template for LAMP amplification. The LAMP detection result shows that the Pseudomonas ayumi sample is positive, and the other samples are all negative, showing that there is no cross-reaction with other common pathogens in seawater culture, indicating that the kit of the present invention...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap