Marker-free gene-deletion attenuated mutant strain derived from Edwardsiella tarda wild strain, related preparation and application thereof

A technology without marker genes and mutant strains, applied in the direction of microorganism-based methods, bacteria, microorganisms, etc., to achieve significant immune effects, clear attenuation mechanism, and the possibility of eliminating virulent pathogens

A technology without marker genes and mutant strains, applied in the direction of microorganism-based methods, bacteria, microorganisms, etc., to achieve significant immune effects, clear attenuation mechanism, and the possibility of eliminating virulent pathogens

CN101629149AActive Publication Date: 2010-01-20EAST CHINA UNIV OF SCI & TECH

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Marker-free gene-deletion attenuated mutant strain derived from Edwardsiella tarda wild strain, related preparation and application thereof
  • Marker-free gene-deletion attenuated mutant strain derived from Edwardsiella tarda wild strain, related preparation and application thereof
  • Marker-free gene-deletion attenuated mutant strain derived from Edwardsiella tarda wild strain, related preparation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Construction of Markerless Gene Deletion Attenuated Mutants

[0033] (1) Construction of aroC gene deletion strain

[0034] 1) PCR amplification to obtain the desired gene fragment

[0035] Such as figure 1 As shown, with the genome of Edwardsiella tarda EIB202 (preservation number CCTCC-M 208068, the preservation place is the Chinese Type Culture Collection Center of Wuhan University, and the preservation date is May 1, 2008) as a template, the following amplification primers are used :

[0036] P1(GAAGATCTATCCCGTTTGTCTGGCTGGAGTTCG),

[0037] P2(CGTCACGGTGCTTCCGCACCCGATCATCCT),

[0038] P3(ATCGGGTGCGGAAGCACCGTGACGAGATCA),

[0039] P4(ACATGCATGCCAGCCACAACCACATGCGTTTACGC),

[0040] First, use P1 and P2, P3 and P4 to amplify the upper and lower fragments F1 and F2 required by Overlap PCR respectively. After each fragment was recovered, the aroC deletion fragment F1F2 was obtained by using P1 and P4 using the Overlap PCR technique.

[0041] 2) Recover eac...

Embodiment 2

[0061] Embodiment 2: Taking zebrafish (Danio rerio) as the semi-lethal dose LD of experimental animals 50 Determination:

[0062] The fish used in the experiment were first placed in the SPF (Specific Pathogen Free) laboratory to adapt to breeding for 1 week to remove abnormal individuals. Before the infection test, the SPF test fish were stocked in a 0.5L infection test tank in the Challenge Lab, and continued to be fed for 1 week, with 10 fish (average body length 2.5-3cm, body weight 0.2g) in each tank. The experimental water tank replaced 1 / 2 volume of cultured water with sterile old water every day, and the water temperature was 22°C, with a fluctuation of 2°C.

[0063] The fish used in the test were randomly divided into groups, and two tanks were tested in parallel in each group. In the infection test, each group of test fish was treated with a certain gradient dose (10 2 -10 7 CFU / tail) of Edwardsiella tarda wild strain and attenuated vaccine strain were artificial...

Embodiment 3

[0068] Embodiment 3: Taking zebrafish as the experimental animal's immune protection test by injection

[0069] The experimental zebrafish were randomly divided into 4 groups, each with 3 parallel tanks, 10 fish per tank. The prepared attenuated live vaccine was immunized by intramuscular injection. The immunization dose is 10 5 CFU / g, intramuscular injection test zebrafish. The control group was injected with sterile normal saline. After 4 weeks of immunization, the immunized zebrafish of each group were infected with live bacteria of Edwardsiella tarda wild strain (intramuscular injection for 10 days). 6 CFU / tail) for artificial infection challenge. Observe and count the control group and the number of immune deaths within 15 days to calculate the immune protection rate of each group (see Table 2).

[0070] Wherein, the immune protection rate was calculated according to the following formula: immune protection rate%=(control group death rate−immune group death rate%) / co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a marker-free gene-deletion attenuated mutant strain derived from an Edwardsiella tarda wild strain, constituting an attenuated live vaccine of the Edwardsiella tarda strain, wherein, chorismate synthase genes aroC of the Edwardsiella tarda strain are deleted; the Edwardsiella tarda strain is particularly an Edwardsiella tarda strain EIB202; and endogenous plasmids of the Edwardsiella tarda strain are further deleted. The invention further provides a preparation for the marker-free gene-deletion attenuated mutant strain derived from the Edwardsiella tarda wild strain, and the related application in preventing mariculture Edwardsiellosis. The marker-free gene-deletion attenuated mutant strain derived from the Edwardsiella tarda wild strain or the related preparation eliminates the potential security risk to the environment and products in most conventional attenuated live vaccines and constitutes a safe, effective and economic vaccine orienting to the mariculture Edwardsiellosis.

Description

technical field [0001] The present invention relates to the technical field of attenuated mutant strains, in particular to the technical field of bacterial live attenuated vaccines for fish, and specifically refers to an unmarked gene-deleted attenuated mutant strain of a wild strain of Edwardsiella tarda, related preparations and applications. Background technique [0002] In view of the continuous growth of the world population and the depletion of natural fishery resources, aquaculture, as a traditional industry, has developed rapidly and effectively in modern times, and has highlighted its important position in society, economy and people's life. According to statistics, in 2002, the total amount of aquatic products in my country accounted for 71% of the global total output and 49.8% of the total output value, ranking first in the world. According to FAO statistics, in 2004 the total amount of aquatic products in my country reached 47.5 million tons. However, due to the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
20 Jan 2010
Publication
CN101629149A
IPC
C12N1/20; A61K39/02; A61P31/04; C12R1/01
Inventors
张元兴; 王鑫