Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Immune regulatory oligodeoxynucleotide for inhibiting differentiation of Th1 and Th17 and application thereof

A deoxynucleotide, th17 technology, applied in the field of compounds with immunomodulatory effects, immunomodulatory oligodeoxynucleotides, can solve problems such as susceptibility to autoimmune diseases, and achieve a strong inhibitory effect

Active Publication Date: 2012-07-11
XIEHE HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI & TECH UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, IFN-γ is an effector molecule of Th1, and there is no IFN-γ signal in IFN-γ-deficient mice or IFN-γR-deficient mice, and autoimmune diseases can still occur, and even more susceptible to autoimmune diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Immune regulatory oligodeoxynucleotide for inhibiting differentiation of Th1 and Th17 and application thereof
  • Immune regulatory oligodeoxynucleotide for inhibiting differentiation of Th1 and Th17 and application thereof
  • Immune regulatory oligodeoxynucleotide for inhibiting differentiation of Th1 and Th17 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0037] The present invention provides an immunoregulatory oligodeoxynucleotide-ODN R01 that inhibits the differentiation of Th1 and Th17, which comprises the nucleotide sequence shown in Sequence Listing 1.

[0038] The immunoregulatory oligodeoxynucleotide-ODNR01 that inhibits Th1 and Th17 differentiation is an oligodeoxynucleotide that can inhibit the phosphorylation of STAT1 and STAT4 and regulate Th1 cell differentiation, and its nucleotide sequence is: TAGGGTAGGGTAGGGTAGGG .

[0039] The immunoregulatory oligodeoxynucleotide-ODNR01 that inhibits the differentiation of Th1 and Th17, and the oligodeoxynucleotide that can inhibit the phosphorylation of STAT3 and regulate the differentiation of Th17 cells, its nucleotide sequence is: TAGGGTAGGGTAGGGTAGGG.

[0040] The immunoregulatory oligodeoxynucleotide-ODN R01 that inhibits Th1 and Th17 differentiation according to claim 1 is modified by sulfuration to increase its stability in cells, or using other nucleic acid carriers, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an immune regulatory oligodeoxynucleotide for inhibiting differentiation of Th1 and Th17 and the application thereof. The immune regulatory oligodeoxynucleotide has the nucleotide sequence TAGGGTAGGGTAGGGTAGGG shown in a sequence table (210) 1, can inhibit the phosphorylation of STAT1 and STAT4 for regulating the cell differentiation of the Th1, and also can inhibit the phosphorylation of STAT3 for regulating the cell differentiation of the Th17. The stability inside the cell can be enhanced by sulfo-modification, or other nucleic acid carriers such as liposome or multivalent cationic polymer and the nucleic acid carrier treated by target modification are used for carrying the compound of the sequence. The oligodeoxynucleotide with the safe effective dose and the pharmaceutical composition thereof which can be accepted pharmaceutically can be applied to multiple immunological diseases for recovering immunologic dissonance, and are superior to specific cellular factor antagonist. As having the structure similar to that of the telomere area of mammal, the immune regulatory oligodeoxynucleotide is safer for the human body than other immunomodulators.

Description

technical field [0001] The invention relates to an immunoregulatory oligodeoxynucleotide for inhibiting the differentiation of Th1 and Th17 and its application, which belongs to the cross research field of immunology and biotechnology medicine. Specifically relates to an immunomodulatory compound, an immunomodulatory oligodeoxynucleotide that inhibits Th1 and Th17 differentiation, clinically useful in autoimmune and other inflammatory diseases with Th1 and / or Th17 overactivation disease. The present invention also specifically relates to the mechanism of action of the immunoregulatory oligodeoxynucleotide, that is, inhibiting the phosphorylation of STAT1, 3, 4 (STATs, Signal transducer and activator oftranscription). Background technique [0002] Excessive activation of the immune system and persistent inflammatory responses lead to the development of various autoimmune and inflammatory diseases. T lymphocytes are the main immune cells that mediate specific immune response...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/117C12Q1/68A61K31/7088A61P37/02A61P29/00A61P1/00A61P3/10A61P31/04A61P5/14A61P25/00A61P9/04A61P9/10A61P19/02A61P17/06
Inventor 程翔廖玉华夏霓肖宏唐婷婷严欣欣谢江娇姚瑞廖梦阳
Owner XIEHE HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI & TECH UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com