Immune regulatory oligodeoxynucleotide for inhibiting differentiation of Th1 and Th17 and application thereof
A deoxynucleotide, th17 technology, applied in the field of compounds with immunomodulatory effects, immunomodulatory oligodeoxynucleotides, can solve problems such as susceptibility to autoimmune diseases, and achieve a strong inhibitory effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0037] The present invention provides an immunoregulatory oligodeoxynucleotide-ODN R01 that inhibits the differentiation of Th1 and Th17, which comprises the nucleotide sequence shown in Sequence Listing 1.
[0038] The immunoregulatory oligodeoxynucleotide-ODNR01 that inhibits Th1 and Th17 differentiation is an oligodeoxynucleotide that can inhibit the phosphorylation of STAT1 and STAT4 and regulate Th1 cell differentiation, and its nucleotide sequence is: TAGGGTAGGGTAGGGTAGGG .
[0039] The immunoregulatory oligodeoxynucleotide-ODNR01 that inhibits the differentiation of Th1 and Th17, and the oligodeoxynucleotide that can inhibit the phosphorylation of STAT3 and regulate the differentiation of Th17 cells, its nucleotide sequence is: TAGGGTAGGGTAGGGTAGGG.
[0040] The immunoregulatory oligodeoxynucleotide-ODN R01 that inhibits Th1 and Th17 differentiation according to claim 1 is modified by sulfuration to increase its stability in cells, or using other nucleic acid carriers, ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
