shRNA for inhibiting mouse TRAF6 gene expression and application thereof
A gene expression, mouse technology, applied in the field of shRNA, can solve problems such as affecting the function of TRAF6
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] (1) Design the DNA sequence of the shRNA that suppresses the mouse TRAF6 gene, as follows:
[0041] GAGTCACTTGGTACGATACTTGTCGAAGAGAAGTGTCGTGCCAAGTGATTC;
[0042] For cloning it into the pENTR / U6 vector, the following DNA sequence was synthesized:
[0043] FP: 5'-CACC -3'
[0044] RP: 5'-AAAA -3';
[0045] The DNA sequence was synthesized by EXIGEN, Japan.
[0046] (2) Anneal the DNA sequences FP and RP at 95°C for 5 minutes, and then place them on ice for 5 minutes; then mix the annealed FP and RP in equimolar amounts, incubate at 37°C for 2 hours, and place them in 2 times frozen anhydrous Precipitate with ethanol (adding 0.1 times 3M sodium acetate at pH 5.6) to obtain double-stranded DNA fragments;
[0047] (3) Ligate the pENTR / U6 vector (purchased from Invitrogen) with the double-stranded DNA fragment obtained in step (2) to obtain the recombinant vector pENTR / U6-TRAF6-shRNA;
[0048] The connection system is as follows:
[0049] Double-stranded DNA fragme...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 