Application of Mycobacterium tuberculosis intracellular secondary messager cyclic diguanylate synthase in screening drugs for treating tuberculosis
A technology of Mycobacterium tuberculosis and cyclic diguanylate, applied in the field of medical biology, can solve problems such as the possibility that has not yet been explored
Inactive Publication Date: 2010-10-20
UNIV OF SCI & TECH OF CHINA
View PDF1 Cites 0 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
However, the physiological role of c-di-GMP as a signaling molecule in Mycobacterium tuberculosis and other pathogenic mycobacteria has not been reported, and the possibility of c-di-GMP and its derivatives as new drug molecules for the treatment of tuberculosis has not yet been reported. to be explored
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
Embodiment Construction
[0021] 1. Knockout of c-di-GMP synthetase DGC gene
[0022]Plasmid construction: (1) High-fidelity polymerase PCR was used to amplify the 5'- and 3'-flanking sequences of DGC about 1 kb each. The primers were: AAGCTTGGTCTGGGAGAACCACTTGA, CTCCACTCGGATGCTATCTGTG, AGCCTTCCAGACGCATAACT and CCGCACAGATAGCATCCGAGTGGAGGTGCCGTAACGGCAA. After PCR splicing, the deletion of the DGC open reading frame (ORF, see the gene sequence of DGC, the protein sequence encoded by the DGC gene, and the attached figure 1 ) of the 2kb fragment;
[0023] (2) This fragment was digested with HindIII and KpnI, and ligated into p1NIL vector to form pN-DGC plasmid.
[0024] (3) The pGOAL19 plasmid was digested with PacI, and the fragments containing 3 screening genes of sacB-lacZ-hyg were recovered and inserted into the pN-DGC treated in the same way to obtain the final gene knockout plasmid pNK-DGC (see appendix figure 2 ).
[0025] Competent cell preparation: Mycobacterium tuberculosis H37Ra was cultured...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Login to View More
Abstract
The invention discloses application of a Mycobacterium tuberculosis intracellular secondary messager cyclic diguanylate synthase in screening drugs for treating tuberculosis, and the gene encoded protein of the Mycobacterium tuberculosis intracellular secondary messager cyclic diguanylate synthase is composed of three structure domains of GAF, GGDEF and EAL. By inducing outside hypoxia and NO / CO environments so as to regulate and control the physiological functions of latent infective capability of Mycobacterium tuberculosis through c-di-GMP signal transduction, and the deletion of the cyclicdiguanylate synthase has no influence on bacteria growth, but can result in oxygen overquick consumption of the Mycobacterium tuberculosis in the hypoxia environment, intracellular coenzyme nicotinamide adenine dinucleotide (NAD) level to be lower than the level of a wild strain in the hypoxia environment, down-regulation of genes relative to the Mycobacterium tuberculosis latent capability in the hypoxia environment, weakened viability in the hypoxia environment, and decreased capability of restoring growth of Mycobacterium tuberculosis entering into an oxygen sufficient environment from thehypoxia environment. Therefore, the Mycobacterium tuberculosis intracellular secondary messager cyclic diguanylate synthase can be used as a drug target to screen the drugs for treating tuberculosis both in a latent stage and in an onset stage.
Description
1. Technical field [0001] The invention belongs to the field of medical biotechnology, and specifically relates to a mycobacterium tuberculosis intracellular secondary messenger cyclic diguanylate synthetase, which is used as a drug target for screening and treating latent tuberculosis and onset tuberculosis drugs. 2. Background technology [0002] Tuberculosis is an infectious disease that seriously endangers human health. It is caused by chronic infection of Mycobacterium tuberculosis (Mycobacterium tuberculosis, referred to as Mycobacterium tuberculosis). It is the second killer of infectious diseases after AIDS. The severity of tuberculosis in my country ranks second in the world. According to the fourth tuberculosis epidemiological sampling survey, one-third of the country's population is latently infected with Mycobacterium tuberculosis, and the total drug resistance rate is 27.8%. At present, the first-line anti-tuberculosis drugs were all invented in the 1950s and 19...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/25C12N15/52
Inventor 孙宝林洪宇植方海红于丹周小丹朱峰
Owner UNIV OF SCI & TECH OF CHINA