Recombinant mycobacterium smegmatis strain capable of expressing mycobacterium tuberculosis Ag 85B and ESAT-6 fusion protein and application thereof

A technology of Mycobacterium tuberculosis and Mycobacterium smegmatis, applied in bacteria, antibacterial drugs, bacterial antigen components, etc., can solve the problems of cell wall thickness, high nutritional requirements, slow growth, etc.

Inactive Publication Date: 2010-11-03
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Introducing exogenous genes into mycobacteria to construct recombinant mycobacterial live vaccines is one of the important directions of new TB vaccine research. Most domestic and foreign studies use BCG as the carrier of mycobacterial live vaccines, but recombinant BCG vaccines still exist as follows: Disadvantages: slow growth, high nutritional requirements, it takes more than 10 hours to cultivate one generation; the cell wall is thick and rich in lipids, which hinders the molecular transportation including exogenous DNA; the transformation efficiency is low; the expression of exogenous genes requires special vectors, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant mycobacterium smegmatis strain capable of expressing mycobacterium tuberculosis Ag 85B and ESAT-6 fusion protein and application thereof
  • Recombinant mycobacterium smegmatis strain capable of expressing mycobacterium tuberculosis Ag 85B and ESAT-6 fusion protein and application thereof
  • Recombinant mycobacterium smegmatis strain capable of expressing mycobacterium tuberculosis Ag 85B and ESAT-6 fusion protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0019] Construction of recombinant plasmid pDE-AEL:

[0020] According to the genome sequence of MTB H37Rv strain, 2 pairs of primers were designed. The primers for the ag85b sequence are:

[0021] P1: 5'-TAGGATCCATGACCGCGGGCGCGTTCTC-3', containing BamHI restriction site;

[0022] P2: 5'-GCGAAGCTTTCATGCGAACATCCCAGTGA-3', containing HindIII restriction site.

[0023] The primers for the esat-6 sequence are:

[0024] P1: 5'-GCATCGATGGTGGCTCAGGTGGCTCCGGTGGAGGCGGAAGCGGCGGTGGA GGA TC AACAGAGCAGCAGTGGAATTT-3', containing ClaI restriction site and 48bp linker sequence;

[0025] P2: 5'-GCGAAGCTTTCATGCGAACATCCCAGTGA-3', containing HindIII restriction site.

[0026] The PCR product of the target gene was cloned into the pGEM-T vector for sequencing. After the sequence was identified correctly, it was cloned into the pDE22 vector (mycobacterial secreted expression vector) according to their different restriction sites. The sequence determination showed that the fusion protein was suc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant mycobacterium smegmatis strain capable of expressing mycobacterium tuberculosis Ag 85B and ESAT-6 fusion proteins and application thereof. Recombinant plasmids containing the Ag 85B and ESAT-6 fusion protein genes are turned into mycobacterium smegmatis (AE-MS for short) through electrotransformation, and the preservation serial number thereof is CCTCC M2010097. When used for immunizing mice, the recombinant mycobacterium smegmatis strain AE-MS obtained through screening can induce the immune response level which is stronger than that of the mycobacterium smegmatis. The invention also relates to the application of the structured mycobacterium smegmatis strain to the preparation of preparations or medicaments used for preventing and treating tuberculosis. The recombinant mycobacterium smegmatis expressing the Ag 85B and ESAT-6 fusion genes integrates the advantages of target antigens and live carriers; and after immunization, the recombinant mycobacterium smegmatis can increase the immune protection of an organism by simulating the stronger immune response of the organism, thereby having good prospect of application.

Description

technical field [0001] The invention belongs to the field of tuberculosis vaccines. The invention relates to a recombinant mycobacterium smegmatis strain expressing Ag85B and ESAT-6 fusion protein which can improve the immune effect of vaccines. The invention also relates to the application of the constructed bacterial strain in the preparation of preparations or medicines for the prevention and treatment of tuberculosis. Background technique [0002] Research Status of Tuberculosis and Gene Engineering Vaccine [0003] According to the WHO report, about 2 billion people in the world have been infected with Mycobacterium tuberculosis (MTB), among which those infected by drug-resistant strains may reach 50 million, and there are about 10 million new patients every year, and the annual death toll is as high as 3 million , the death rate of tuberculosis (TB) is second only to AIDS in all infectious diseases. WHO lists TB, together with AIDS and malaria, as the most important...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21A61K39/04A61P31/06C12R1/34
Inventor徐志凯柏银兰王丽梅王平何俊杰康健张薇师长宏张海
OwnerFOURTH MILITARY MEDICAL UNIVERSITY