Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice root hair elongation regulatory gene OsEXP17 promoter and application thereof

A technology for regulating genes and promoters, applied in the field of plant genetic engineering, can solve the problems of few types of crops, no intellectual property rights, limited quantities, etc.

Inactive Publication Date: 2010-11-24
ZHEJIANG UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When these promoters are used to regulate the expression of target genes, because a large number of target proteins appear in unwanted cells, it is often easy to cause abnormalities in species morphology and physiological functions
Although there are also reports on the isolation and cloning of a small number of specific promoters in the world, the types of crops involved are very limited, and we do not have intellectual property rights, which will be limited to production applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice root hair elongation regulatory gene OsEXP17 promoter and application thereof
  • Rice root hair elongation regulatory gene OsEXP17 promoter and application thereof
  • Rice root hair elongation regulatory gene OsEXP17 promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Semi-quantitative RT-PCR results ( figure 1 ) showed that the OsEXP17 gene was only expressed in the roots of rice plants. The primers for the OsEXP17 (LOC_0s06g01920) gene promoter were designed according to the genome sequence of indica rice 9311. The upstream primer sequence (5'-3') was tgaagcccaggtttgattga; the downstream primer sequence (5'-3') was gccatgctattgtcgtcgat. Using the wild-type Kasalath genome as a template, the OsEXP17 gene promoter was amplified with LA Taq DNA Polymerase, with a full length of 2563bp, and its nucleotide sequence is shown in SEQ ID NO:1. After the PCR product was recovered by electrophoresis, it was connected to the pUCm-T vector, transformed into DH5α competent cells, and positive clones were picked, and positive clones were picked for enzyme digestion detection, and sent to the sample for sequencing. Combine the sequenced correct clone with the pBI101.1-GUS plus vector ( figure 2 ) were digested with BamHI and KpnI respectively,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice root hair elongation regulatory gene OsEXP17 promoter. The promoter is nucleotide sequence shown by SEQ ID NO: 1. The invention also discloses application of the rice root hair elongation regulatory gene OsEXP17 promoter, used for constructing transgenosis rice; and the function of the promoter is that efficient expression of downstream coding gene in rice root hair cell can be promoted.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. Specifically, the present invention relates to cloning the upstream promoter sequence of rice OsEXP17 gene coding region and its use. Background technique [0002] The root system is an important organ for plants to absorb water and nutrients, and the root hair is an important part of the physiologically active interface of the functional section of the plant root system. The structure of plant root tip includes four parts: root cap, meristematic zone, elongation zone and maturation zone. Morphological differences between root hair cells and non-root hair cells begin to appear in the meristematic zone; root hairs begin to form in the elongation zone; hair cells mature and fully differentiate in the maturation zone, and root hairs grow and reach maturity (Dolan et al., 1993). Root hairs are some tubular protrusions on root epidermal cells, and the development process of root hairs can be...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113A01H5/00
Inventor 吴平何晓薇莫肖蓉
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products