Unlock instant, AI-driven research and patent intelligence for your innovation.

Promoter of OsRTS1 (oryza sativa root tip specific 1) gene and application thereof

A technology for expressing genes and promoters, which is applied in the field of plant genetic engineering and can solve the problems of few types of crops, no intellectual property rights, and limited number of crops.

Inactive Publication Date: 2011-09-28
ZHEJIANG UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When these promoters are used to regulate the expression of target genes, because a large number of target proteins appear in unwanted cells, it is often easy to cause abnormalities in species morphology and physiological functions
Although there are also reports on the isolation and cloning of a small number of specific promoters in the world, the types of crops involved are very limited, and we do not have intellectual property rights, which will be limited to production applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoter of OsRTS1 (oryza sativa root tip specific 1) gene and application thereof
  • Promoter of OsRTS1 (oryza sativa root tip specific 1) gene and application thereof
  • Promoter of OsRTS1 (oryza sativa root tip specific 1) gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] According to related studies, it is known that OsRTS1 may be a gene specifically expressed in root apex tissue. Specific primers were designed according to the upstream sequence of the OsRTS1 gene coding region, wherein the 5' end of the downstream primer contained the NcoI enzyme recognition site (underlined). Using the genomic DNA of wild-type Nipponbare as a template, a full-length 2435bp OsRTS1 gene promoter was amplified, and its nucleotide sequence was shown in SEQ ID NO: 1 (ie, the sequence described in the sequence listing).

[0021] The primer sequences are as follows:

[0022] Upstream primer: GATTGACATCGATTCCAACCCAACCGTGTT

[0023] Downstream primer: CTA CCATGG ATCGCTGCTTCTCCTCGTCCT

[0024] The extraction method of the genomic DNA of wild-type Nipponbare is:

[0025] The leaves of the wild-type rice variety Nipponbare were cooled and ground with liquid nitrogen, and the genomic DNA was extracted by the CTAB method. The specific process is as follows:

...

Embodiment 2

[0054] Mature rice seeds were dehulled and sterilized, placed on mature embryo induction medium, and cultured in a light incubator at 28°C for 3 weeks. Embryogenic callus tissue (light yellow, dense and spherical) that split naturally was picked, placed in a subculture medium, and subcultured in a light incubator at 28°C to obtain rice callus. Rice calluses were infected with Agrobacterium transformed with OsRTS1P-GUSplus plasmid, co-cultured, and selected on a medium containing G418 antibiotic. The callus capable of normal growth is differentiated, rooted, seedling-trained and transplanted to obtain transgenic plants and transgenic plants. The rice genetic transformation system mediated by Agrobacterium (EHA105) was optimized based on the method reported by Hiei et al. (1994). The offspring of transgenic seedlings obtained after staining with GUS staining solution figure 2 shown.

[0055] It indicated that GUS driven by the OsRTS1 gene promoter was specifically expressed ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a promoter of an OsRTS1 (oryza sativa root tip specific 1) gene. The promoter is a nucleotide sequence shown as SEQIDNO: 1. The OsRTS1 gene is used for constructing genetically modified oryza sativa and establishing an oryza sativa tissue specific expression mark strain. The promoter has the functions of being capable of starting the specific expression of downstream coding genes in newly-born epidermis cells near oryza sativa root tip meristematic zones of oryza sativa and also starting the specific expression of the downstream coding genes in oryza sativa anther.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. Specifically, the present invention relates to cloning the upstream promoter nucleotide sequence of the rice OsRTS1 (rice root tipspecific 1) gene coding region, the function of which is to activate the downstream coding gene in newborn epidermal cells near the rice root tip meristem The specific expression of the gene and the specific expression of the downstream coding gene in the rice anther can be initiated. Background technique [0002] The root system is an important organ for plants to absorb water and nutrients. The root structure can be roughly divided into four parts: root cap, meristematic zone, elongation zone and root hair zone. Cells divide and proliferate continuously in the meristematic zone, and new cells differentiate and develop to form various tissues of the root. Developing cells increase in size, forming zones of elongation. The volume of the developed cells no l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113A01H5/00
Inventor 张麝龙莫肖蓉吴平
Owner ZHEJIANG UNIV