Promoter of OsRTS1 (oryza sativa root tip specific 1) gene and application thereof
A technology for expressing genes and promoters, applied in the field of plant genetic engineering, can solve problems such as limited quantity, no intellectual property rights, abnormal species morphology and physiological functions, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] According to related studies, it is known that OsRTS1 may be a gene specifically expressed in root apex tissue. Specific primers were designed according to the upstream sequence of the OsRTS1 gene coding region, wherein the 5' end of the downstream primer contained the NcoI enzyme recognition site (underlined). Using the genomic DNA of wild-type Nipponbare as a template, the full-length 2435bp OsRTS1 gene promoter was amplified, and its nucleotide sequence was shown in SEQ ID NO: 1 (ie, the sequence described in the sequence listing).
[0021] The primer sequences are as follows:
[0022] Upstream primer: GATTGACATCGATTCCAACCCAACCGTGTT
[0023] Downstream primer: CTA CCATGG ATCGCTGCTTCTCCTCGTCCT
[0024] The extraction method of the genomic DNA of wild-type Nipponbare is:
[0025] The leaves of the wild-type rice variety Nipponbare were cooled and ground with liquid nitrogen, and the genomic DNA was extracted by the CTAB method. The specific process is as follows: ...
Embodiment 2
[0054] Mature rice seeds were dehulled and sterilized, placed on mature embryo induction medium, and cultured in a light incubator at 28°C for 3 weeks. Embryogenic callus tissue that split naturally (light yellow, compact and spherical) was picked, placed in a subculture medium, and subcultured in a light incubator at 28°C to obtain rice callus. Rice calluses were infected with Agrobacterium transformed with OsRTS1P-GUSplus plasmid, co-cultured, and selected on a medium containing G418 antibiotic. The callus capable of normal growth is differentiated, rooted, seedling-trained and transplanted to obtain transgenic plants and transgenic plants. The rice genetic transformation system mediated by Agrobacterium (EHA105) was optimized based on the method reported by Hiei et al. (1994). The offspring of transgenic seedlings obtained after staining with GUS staining solution figure 2 shown.
[0055] It indicated that GUS driven by the OsRTS1 gene promoter was specifically expresse...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com