Unlock instant, AI-driven research and patent intelligence for your innovation.

Promoter of oryza sativa rice root tip specific 3 (OsRTS3) expression gene and application thereof

A technology for expressing genes and rice roots, which is applied in the field of plant genetic engineering, can solve the problems of abnormal species morphology and physiological functions, few types of crops, and no intellectual property rights, etc., and achieve the effect of large technical reserve value

Inactive Publication Date: 2013-04-10
ZHEJIANG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When these promoters are used to regulate the expression of target genes, because a large number of target proteins appear in unwanted cells, it is often easy to cause abnormalities in species morphology and physiological functions
Although there are also reports on the isolation and cloning of a small number of specific promoters in the world, the types of crops involved are very limited, and we do not have intellectual property rights, which will be limited to production applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoter of oryza sativa rice root tip specific 3 (OsRTS3) expression gene and application thereof
  • Promoter of oryza sativa rice root tip specific 3 (OsRTS3) expression gene and application thereof
  • Promoter of oryza sativa rice root tip specific 3 (OsRTS3) expression gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] According to related research, it is known that OsRTS3 may be a gene specifically expressed in root tip tissue. Design specific primers according to the upstream sequence of the OsRTS3 gene coding region, and use the genomic DNA of wild-type Nipponbare as a template to amplify the OsRTS3 gene promoter of full length 2607bp, its nucleotide sequence is shown in SEQ ID NO: 1 (i.e. as shown in described in the sequence listing).

[0020] The primer sequences are as follows:

[0021] Upstream primer: AGGCCGAAAGACTAAGAGTTGAG

[0022] Downstream primer: ATACCATGGAACGGCTGCATAACTAA

[0023] The extraction method of the genomic DNA of wild-type Nipponbare is:

[0024] The leaves of the wild-type rice variety Nipponbare were cooled and ground with liquid nitrogen, and the genomic DNA was extracted by the CTAB method. The specific process is as follows:

[0025] 1) Add 2-ME / CTAB preheated at 65°C to the pulverized tissue, mix to make it fully wet, incubate at 65°C for 10-60min,...

Embodiment 2

[0053] Mature rice seeds were dehulled and sterilized, placed on mature embryo induction medium, and cultured in a light incubator at 28°C for 3 weeks. Embryogenic callus tissue that split naturally (light yellow, compact and spherical) was picked, placed in a subculture medium, and subcultured in a light incubator at 28°C to obtain rice callus. Rice calluses were infected with Agrobacterium transformed with OsRTS3P-GUSplus plasmid, co-cultured, and selected on the medium containing G418 antibiotic. The callus capable of normal growth is differentiated, rooted, seedling-trained and transplanted to obtain transgenic plants and transgenic plants. The rice genetic transformation system mediated by Agrobacterium (EHA105) was optimized based on the method reported by Hiei et al. (1994). The offspring of transgenic seedlings obtained after staining with GUS staining solution image 3 shown.

[0054] It indicated that GUS driven by the OsRTS3 gene promoter was specifically express...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a promoter of an oryza sativa rice root tip specific 3 (OsRTS3) expression gene. The promoter is the nucleotide sequence as shown in the SEQ ID NO:1. The invention also discloses application of the promoter of an OsRTS3 expression gene. The promoter is applied to construction of genetically modified rice in order to construct an OsRTS3 expression strain. The promoter has the function of promoting specific expression of the downstream coding genes in the OsRT quiescent centre.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. Specifically, the present invention relates to cloning the upstream promoter nucleotide sequence of the rice OsRTS3 (rice root tip specific 3) gene coding region. Background technique [0002] The root system is an important organ for plants to absorb water and nutrients. The root structure can be roughly divided into four parts: root cap, meristematic zone, elongation zone and root hair zone. Cells divide and proliferate continuously in the meristematic zone, and new cells differentiate and develop to form various tissues of the root. Developing cells increase in size, forming zones of elongation. The volume of the developed cells no longer increases rapidly, and hair-like protrusions occur on the cells at the epidermis to form the root hair area. The increase in the volume of cells in the elongation zone creates pressure to push the meristematic zone forward, and part of the meriste...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/00
Inventor 莫肖蓉张麝龙吴平
Owner ZHEJIANG UNIV