Supercharge Your Innovation With Domain-Expert AI Agents!

Primer, probe and chip for detecting and identifying salmonella typhosa nucleic acid segment

A technology of Salmonella nucleic acid and Salmonella typhi, which is applied in the direction of DNA/RNA fragments, microbial detection/inspection, and resistance to vector-borne diseases. specific effect

Active Publication Date: 2011-06-01
SHANGHAI BIOCHIP
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Bacterial culture and Widal reaction based on immunology are traditional methods for diagnosing typhoid bacillus. Bacterial culture is called the gold standard because of its high specificity and no false positives. It is the most commonly used diagnostic basis for the diagnosis of typhoid fever. Culture results are easily affected by conditions such as antibiotics and time-consuming

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe and chip for detecting and identifying salmonella typhosa nucleic acid segment
  • Primer, probe and chip for detecting and identifying salmonella typhosa nucleic acid segment
  • Primer, probe and chip for detecting and identifying salmonella typhosa nucleic acid segment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0029] I. Design of primers and probes

[0030] The existing Salmonella typhi genome sequence was compared, and a highly conserved segment with no secondary structure was selected [Salmonella typhi H1d gene sequence (GenBank X16406.1, 228bp), as shown in SEQ ID NO.1], and multiple pairs were designed. For primers and probes, the length of the primer is generally about 20 bases, and the length of the probe is generally about 25 bases. There is no complementary sequence between and within the primers. The difference between the Tm values ​​of the two primers does not exceed 3°C. Through experiments, the optimal primer and probe combination was screened as follows:

[0031] The sequence of the upstream primer F-080105 (shown in SEQ ID NO. 2) used to detect and identify the nucleic acid fragment of Salmonella typhi: AATGGGCGACGATTTCTATG

[0032] The sequence of the downstream primer R-080105 (shown in SEQ ID NO. 3) used to detect and identify the nucleic acid fragment of Salmonella typh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer, a probe and a chip for detecting and identifying a salmonella typhosa nucleic acid segment. The primer sequence comprises a primer pair sequence comprising an upstream primer sequence shown in SEQ ID NO.2 and a downstream primer sequence shown in SEQ ID NO.3. The probe sequence comprises 5'-Zc-P-3', wherein Zc at the 5' end is a sequence complementary to a probe Z fixed on a gene chip, and P at the 3' end is a specific sequence of a salmonella typhosa gene shown in SEQ ID NO.4. The gene chip comprises a probe for detecting and identifying the salmonella typhosa nucleic acid segment and a probe Z fixed on a solid-phase carrier. The primer, the probe and the chip provided by the invention can specifically and purposively detect the salmonella typhosa.

Description

Technical field [0001] The invention relates to a primer, a probe and a chip, in particular to a primer, a probe and a chip for detecting and identifying nucleic acid fragments of Salmonella typhi. Background technique [0002] Typhoid fever is an acute infectious disease transmitted by water or food contaminated by Salmonella typhi, and is classified as a Class B infectious disease in the "Law of the People's Republic of China on the Prevention and Control of Infectious Diseases". Salmonella typhi is an important source of pollution in water and food. People have been infected by mouth after eating contaminated drinking water and food. The clinical features are long-term fever, symptoms of systemic poisoning, relatively slow pulse, hepatosplenomegaly, roseola and leukopenia, etc. The main complications are intestinal bleeding and intestinal perforation. In addition to causing intestinal diseases, it can also cause other organs or systemic infections, which seriously threaten pe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/10C12N15/11
CPCY02A50/30
Inventor 张春秀黄晓卫陈金丝曹欢邵祥强肖华胜
Owner SHANGHAI BIOCHIP
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More