Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

99 results about "Salmonella typhosa" patented technology

Salmonella typhosa - a form of salmonella that causes typhoid fever. Salmonella typhi, typhoid bacillus. salmonella - rod-shaped Gram-negative enterobacteria; cause typhoid fever and food poisoning; can be used as a bioweapon.

Novel bacteriophage and antibacterial composition comprising the same

Disclosed herein is a novel bacteriophage which has specific bactericidal activity against one or more Salmonella bacteria selected from the group consisting of Salmonella Enteritidis, Salmonella Typhimurium, Salmonella Gallinarum, and Salmonella Pullorum without affecting beneficial bacteria, in addition to showing excellent tolerance to acid, heat and desiccation. The novel bacteriophage can be widely used as an active ingredient for therapeutic agents, animal feeds or drinking water, cleaners and sanitizers for preventing and treating the infectious diseases caused by Salmonella Enteritidis, Salmonella Typhimurium, Salmonella Gallinarum or Salmonella Pullorum including salmonellosis, Salmonella food poisoning, Fowl Typhoid, and Pullorum disease or for controlling the salmonella bacteria.
Owner:CJ CHEILJEDANG CORP

Novel Bacteriophage and Antibacterial Composition Comprising the Same

The present invention relates to a novel bacteriophage, more particularly, a bacteriophage that has a specific bactericidal activity against one or more Salmonella bacteria selected from the group consisting of Salmonella Enteritidis, Salmonella Typhimurium, Salmonella Gallinarum, and Salmonella Pullorum. Further, the present invention relates to a composition for the prevention or treatment of infectious diseases including salmonellosis and Salmonella food poisoning caused by Salmonella Enteritidis or Salmonella Typhimurium, Fowl Typhoid caused by Salmonella Gallinarum, and Pullorum disease caused by Salmonella Pullorum, comprising the bacteriophage as an active ingredient. Furthermore, the present invention relates to a feed additive, drinking water, a cleaner and a sanitizer, comprising the bacteriophage as an active ingredient.
Owner:CJ CHEILJEDANG CORP

Lactobacillus plantarum AB-3 having bacteria inhibition activity and application thereof

The invention provides a lactobacillus plantarum AB-3 strain having an activity of resisting phytophthora melonis kalsura, of which the accession number is CGMCC No.9655. The lactobacillus plantarum AB-3 has effective inhibition properties on escherichia coli, salmonella typhimurium and shigella flexneri, has effective inhibition properties on the phytophthora melonis kalsura, fusarium oxysporum, penicillium roqueforti and glomerella cingulata and is excellent in thermostability. A fermentation supernate of the strain shows a significantly increased bacteria inhibition rate after treatment at 100 DEG C and is enhanced in bacteria inhibition activity through enzymolysis by a neutral protease. The fermentation supernate of the strain has a storage resistance property and is excellent in bacteria inhibition activity even after normal storage for 20 days.
Owner:INNER MONGOLIA AGRICULTURAL UNIVERSITY

Bacteriophage capable of controlling Salmonella typhimurium and application thereof

ActiveCN107099511ASpecific killing activityDoes not cause resistanceAntibacterial agentsViral/bacteriophage medical ingredientsAcid-fastBacteroides
The invention discloses a bacteriophage capable of controlling Salmonella typhimurium; the bacteriophage is classified and named Salmonella typhimuriumphage Phi Sa-1, and is already collected in China Center for Type Culture Collection on 28 April, 2017, under CCTCC M2017217 in Wuhan University, China. The bacteriophage of the invention has specific killing activity for Salmonella typhimurium, and is capable of selectively killing specific pathogenic bacteria without killing beneficial bacteria or causing drug resistance. The bacteriophage also has excellent acid tolerance and heat resistance, may be prepared into feed additives, drinking water additives, feeds, drinking water, detergents or sanitizers and other various products, and is capable of killing Salmonella typhimurium under wide temperature range and pH range.
Owner:山东宝来利来生物工程股份有限公司

Aptamer based salmonella typhimurium detection biosensor and preparation method thereof

The invention relates to an aptamer based salmonella typhimurium detection biosensor and a preparation method thereof. Signal amplification is realized by continuous generation and cyclic utilization of Primer, and consequently high-sensitivity detection of salmonella typhimurium is realized, and lower detection limit can be acquired. The aptamer based salmonella typhimurium detection biosensor is high in specificity and sensitivity, low in cost and quick in detection. By the detection method, a salmonella typhimurium detection limit is 5-15cfu / mL, and a detection range is 1*10-1*107cfu / mL.
Owner:UNIV OF JINAN

Novel bacteriophage and antibacterial composition comprising same

The present invention relates to a novel bacteriophage, and more specifically to a bacteriophage that can specifically destroy one or more Salmonella spp. selected from a group consisting of Salmonella enteritidis, Salmonella typhimurium, Salmonella gallinarum and Salmonella pullorum. The present invention further relates to a composition containing the bacteriophage as an active ingredient for the prevention or treatment of infectious diseases such as salmonellosis and salmonella foodborne intoxication induced by Salmonella enteritidis or Salmonella typhimurium, fowl typhoid induced by Salmonella gallinarum, pullorum induced by Salmonella pullorum, etc. Moreover, the present invention relates to animal feeds, drinking water, detergent and disinfectant containing the bacteriophage as an inactive ingredient.
Owner:CJ CHEILJEDANG CORP

Preparation and detection method of Bacterium typhosum rapid detection reagent kit

The invention relates to a method for fast detecting bacteria specimen by loop mediate disothermal amplification technology (LAMP), particularly to a method for preparing a reagent kit for fast detecting salmonella typhosa and a method for detecting Salmonella typhosa. The reagent kit contains loop mediate disothermal amplification reaction liquid, Bst DNA polymerase and developer; the loop mediate disothermal amplification reaction liquid includes reaction buffer liquid, dNTP, bitter salt, upstream inner primer 5- TTACGTCACCAACGAC ACGGGACGTATTGGGCAATGACTGG-3, downstream inner primer 5- CGGTAAATACCATCCCCACGGCT AACGCAGCGAGAATGGC -3, upstream outer primer 5- GTCGCGTACTTTACGCCAT-3, downstream outer primer 5- ACCCTGACCATCCACCAG -3 and lycine; the method for detecting Salmonella typhosa comprises the steps of extracting bacterial DNA, loop mediate disothermal amplifying of the salmonella typhosa, and development detecting. The invention has the following advantages, including high speed, strong specificity, high sensitivity and low cost.
Owner:INSPECTION & QUARANTINE TECH CENT SHANDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU

Salmonella broad-spectrum virulent bacteriophage as well as preparation method and application thereof

ActiveCN112662636AHigh potencyHas cracking abilityAntibacterial agentsDigestive systemSalmonella paratyphi ASerotype
The invention provides a salmonella broad-spectrum virulent bacteriophage. The preservation number of the bacteriophage is CCTCC NO: M 2020839. The invention also provides a preparation process and application of the salmonella broad-spectrum virulent bacteriophage, and the preparation process comprises fermentation and extraction; in the step of fermentation, a salmonella gallinarum attenuated vaccine strain is used as host bacteria for bacteriophage fermentation. The bacteriophage XPARCPS02 disclosed by the invention can be used for cracking salmonella of various serotypes and also has different degrees of cracking effects on drug-resistant bacteria; the salmonella typhimurium lysate lysate has a cracking capability on salmonella typhimurium, salmonella typhimurium drug-resistant bacteria, salmonella gallinarum, salmonella enteritidis, salmonella enteritidis drug-resistant bacteria, salmonella typhimurium, salmonella pullorum, salmonella paratyphi A, salmonella paratyphi B and salmonella dubicularis.
Owner:山东仙普爱瑞科技股份有限公司

Salmonella bacteriophage RDP-NSA-19050 with wide lysis spectrum and application thereof

The invention discloses a salmonella phage RDP-NSA-19050 with a wide lysis spectrum, wherein the preservation number is CGMCC No.21415, the gene length is 87591 bp; after sequencing is carried out on whole genes, it is found that the salmonella phage RDP-NSA-19050 does not have virulence genes and lyogenic genes, and the salmonella phage RDP-NSA-19050 has a good lysis spectrum. The salmonella bacteriophage RDP-NSA-19050 provided by the invention can be used for cracking a plurality of pathogenic bacteria such as salmonella steulani, salmonella gallinarum, salmonella typhimurium, salmonella paratyphi A, salmonella paratyphi B, salmonella typhimurium, salmonella enteritidis and salmonella kkinensis; the salmonella bacteriophage RDP-NSA-19050 has the characteristics of wide splitting spectrum and high splitting rate, can be independently used, can also be compounded with bacteriophages of other escherichia coli and salmonella and probiotics for use, and can effectively reduce the death rate of chicken infected with salmonella.
Owner:RECOM QINGDAO BIOTECH CO LTD

Detection assembly for detecting bacteria

InactiveCN104297474AAvoid pairing problemsHigh sensitivityMaterial analysisBiotechnologySpecific antibody
The invention relates to a detection assembly for detecting bacteria based on a bacteria fluorescent staining technique. A single antibody is utilized for detecting thalli which are stained by fluorescence; an escherichia coli O157:H7 antibody, a listeria monocytogenes antibody and a salmonella typhimurium antibody are sprayed on a test strip, and the test strip acts an immunochromatography test strip with three detection lines (T1, T2 and T3 lines). The detection assembly for detecting bacteria has the advantages that fluorochrome is used for pre-staining thalli, and the respective specific antibody is utilized again and is sprayed onto the T lines of the test strip so as to capture target thalli in a mixed sample, so that the thalli in the sample are detected rapidly and specifically; the detection assembly for detecting bacteria can be used for simultaneously detecting the food-borne pathogenic bacteria including the escherichia coli O157:H7 antibody, the listeria monocytogenes antibody and the salmonella typhimurium.
Owner:NANCHANG UNIV

PCR detecting kit for fast identifying pullorum disease and chicken salmonella typhosa

The invention belongs to the field of biotechnology detection, and particularly relates to a PCR detecting kit for fast identifying pullorum disease and chicken salmonella typhosa. The kit comprises flhB gene detection primers, and the flhB gene detection primers comprise a forward primer with the nucleotide sequence shown as SEQ ID NO.1 and a reverse primer with the nucleotide sequence shown as SEQ ID NO.2. The kit can fast identify the pullorum disease / chicken salmonella typhosa at high flux, and can be adopted as an auxiliary method for salmonella traditional serological typing, and a simple, fast and good-repeatability novel method is provided for monitoring and laboratory diagnosis of pullorum disease / chicken salmonella typhosa.
Owner:YANGZHOU UNIV

Bacteriophage and antibacterial composition comprising the same

Disclosed herein is a novel bacteriophage which has specific bactericidal activity against one or more Salmonella bacteria selected from the group consisting of Salmonella enteritidis, Salmonella typhimurium, Salmonella gallinarum, and Salmonella pullorum without affecting beneficial bacteria, in addition to showing excellent tolerance to acid, heat and desiccation. The novel bacteriophage of the present invention can be widely used as an active ingredient for therapeutic agents, animal feeds or drinking water, cleaners and sanitizers for preventing and treating the infectious diseases caused by Salmonella enteritidis, Salmonella typhimurium, Salmonella gallinarum or Salmonella pullorum including salmonellosis, Salmonella food poisoning, Fowl Typhoid, and Pullorum disease or for controlling the Salmonella bacteria. The present invention also provides important insights into prevention and control strategies against Salmonella infection and suggests that the use of bacteriophage can be a novel, safe, and effectively plausible alternative to antibiotics for the prevention of Salmonella infection in poultry.
Owner:CJ CHEILJEDANG CORP

Novel bacteriophage and antibacterial composition comprising the same

Disclosed herein are is a novel bacteriophage which has specific bactericidal activity against one or more Salmonella bacteria selected from the group consisting of Salmonella Enteritidis, Salmonella Typhimurium, Salmonella Gallinarum, and Salmonella Pullorum without affecting beneficial bacteria. Disclosed are also compositions, animal feeds or drinking water, cleaners and sanitizers for preventing and treating the infectious diseases caused by Salmonella Enteritidis, Salmonella Typhimurium, Salmonella Gallinarum or Salmonella Pullorum including salmonellosis, Salmonella food poisoning, Fowl Typhoid, and Pullorum disease or for controlling the salmonella bacteria.
Owner:CJ CHEILJEDANG CORP

LAMP primer combination for detecting 8 environmental pathogens of dairy cow mastitis and application thereof

The invention discloses an LAMP primer combination for detecting 8 environmental pathogens of dairy cow mastitis and application thereof. The primer combination provided by the invention is composed of 48 primers shown in sequence 1 to sequence 48. The primer combination provided by the invention can be used for detecting whether a to-be-detected bacterium is Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Streptococcus dysgalactiae, Streptococcus uberis, Salmonella typhimurium, Proteus mirabilis or Candida albicans, and can be used for detecting whether a to-be-detected sample contains Escherichia coli and / or Klebsiella pneumonia and / or Pseudomonas aeruginosa and / or Streptococcus dysgalactiae and / or Streptococcus uberis and / or Salmonella typhimurium and / or Proteus mirabilis and / or Candida albicans. The primer combination provided by the invention is used for identifying and detecting the 8 environmental pathogens of dairy cow mastitis, has high specificity and high sensitivity, and can realize simple, rapid and accurate detection, thus having great popularization value.
Owner:CAPITALBIO CORP

Fowl salmonella gallinarum attenuated isolated strain and application thereof

The invention relates to a fowl salmonella gallinarum attenuated isolated strain and application thereof. The isolated strain is preserved in the China General Microbiological Culture Collection Center, Beijing, China, on July 2, 2018, has a preservation number of CGMCC No.16049, and is classified and named as Salmonella Gallinarum. The strain is attenuated to chicken of different ages, is apathogenic, and can be used as a strain vector for preventing livestock salmonella gallinarum infection and preventing infectious diseases of livestock (chicken). The fowl salmonella gallinarum attenuated isolated strain provides data reference to evaluating the toxicity of salmonella attenuated vaccine strains and potential as the strain vector of livestock (chicken) live vaccines.
Owner:YANGZHOU UNIV

Biosensor for detecting salmonella typhimurium and application of biosensor

The invention discloses a biosensor for detecting salmonella typhimurium and application of the biosensor, and belongs to the technical field of harmful microorganism detection. The biosensor is composed of carbon quantum dots Td-CD modified by a salmonella typhimurium nucleic acid aptamer and magnetic beads Td-MB modified by the salmonella typhimurium nucleic acid aptamer. The salmonella typhimurium nucleic acid aptamer and other nucleic acids are assembled through sequence design to form a DNA regular tetrahedron structure, and then the DNA regular tetrahedron structure is respectively usedfor modifying carbon quantum dots and magnetic beads. The method for detecting salmonella typhimurium by adopting the biosensor is simple and convenient to operate and short in consumed time, complexpretreatment does not need to be carried out on a sample to be detected, and the detection cost is low; the biosensor can effectively amplify signals of salmonella typhimurium, can be used for detecting low-concentration salmonella typhimurium in food, and achieves qualitative and quantitative analysis of salmonella typhimurium.
Owner:QINGDAO AGRI UNIV

Salmonella typhimurium bacteriophage T156 and application thereof

ActiveCN111944766AOvercoming the disadvantages of isotype specificityImprove the bactericidal effectBiocideMicroorganism based processesSalmonella frintropBacteriophage
The invention discloses a salmonella typhimurium bacteriophage T156 and application thereof. The bacteriophage is a broad-spectrum type, can split salmonella and a drug-resistant strain thereof, and is identified as a caudal bacteriophage long-tail bacteriophage family; and the bacteriophage T156 has stable titer with the pH of 3-12 and the temperature of 30-50 DEG C. The bacteriophage provided bythe invention can be used for effectively controlling salmonella typhimurium ATCC 13311 in a food sample, and has the characteristics of high specificity, no residue and safety compared with antibiotics and chemical preservatives.
Owner:HUAZHONG AGRI UNIV

Growth inhibitory composition against pathogenic bacteria of meat based food stuff comprising igy

The invention relates to growth-inhibitory composition against pathogenic bacteria of meat based food stuff comprising IgY. The IgY is a specific immunoglobulin derived from yolk of egg. 12 representative bacteria and other microbes deteriorating quality of process meat products that the IgY of the invention targets include Aeromonas hydrophila, Bacillus cereus, which comprises Aeromonas hydrophil, Bacillus cereus, Camphlobacter jejuni, Clotridium perfringens, 0157:H7 (Escherichia col, 0157:H7), Lactobacillus, Listeria monocytogens, Saccharomyces cerevisiae, Salmonella enteritidis, Salmonella typhimurium, Staphylococcus aureus, Staphylococcus epidermidis. The 12 representative bacteria antigen forms are respectively injected the interior of chicks to obtain the IgY of the 12 antigens.
Owner:CJ CHEILJEDANG CORP +1

Pediococcus pentosaceus NHB-PpA9601 and application thereof

The invention provides a pediococcus pentosaceus NHB-PpA9601. The pediococcus pentosaceus NHB-PpA9601 is separated from intestinal tracts of white feather broilers, and is preserved in China General Microbiological Culture Collection Center (CGMCC for short, the address is Institute of Microbiology, Chinese Academy of Sciences, 3 #, 1 # yard, West Beichen Road, Chaoyang District, Beijing, the postal code is 100101), the preservation number is CGMCC NO.22646, and the preservation date is May 31, 2021. The pediococcus pentosaceus NHB-PpA9601 has the advantages that the obvious probiotic property is realized, the growth and reproduction of pathogenic bacteria such as intestinal pathogenic escherichia coli, staphylococcus aureus, salmonella suis, salmonella choleraesuis, salmonella gallinarum, salmonella pullorum, salmonella typhimurium, salmonella, shigella, bacillus perfringens, proteus penneri, aeromonas hydrophila and vibrio parahaemolyticus can be effectively inhibited; the pediococcus pentosaceus NHB-PpA9601 can be used for producing a wet-based fermented feed, and can be used for effectively improving intestinal health and increasing economic benefits.
Owner:NEW HOPE LIUHE +2

Application of bacillus amyloliquefaciens in prevention of diarrhea of weaned piglets

The invention relates to bacillus amyloliquefaciens and application of the bacillus amyloliquefaciens in prevention of diarrhea of weaned piglets. The invention provides a bacillus amyloliquefaciens strain BA40, which can be used for inhibiting common porcine intestinal pathogens, namely escherichia coli K88, salmonella typhimurium and staphylococcus aureus, and has the capabilities of resisting acid, bile salt and pancreatin. After the bacillus amyloliquefaciens is activated, the viable count of the bacillus amyloliquefaciens reaches 108-109 CFU / mL, 6-day-old suckling piglets are subjected to intragastric administration through the mouth, and weaning is performed after 1 mL of the suckling piglets are continuously administrated to the stomach for 24 days. The bacillus amyloliquefaciens provided by the invention can improve weaning weight gain of piglets of pigs and diversity of intestinal flora, reduce diarrhea of the weaned piglets, reduce diarrhea rate, reduce inflammatory factors, promote nutrient absorption and improve oxidation resistance and disease resistance of organisms, and provides a new way for nutrient regulation and control under antibiotic-free breeding.
Owner:广州百仕肽生物科技有限公司

Test paper box for detecting salmonella typhimurium

InactiveCN104297476AAvoid pairing problemsSimple processMaterial analysisFluorescent stainingEngineering
The invention relates to a test paper box which is based on a bacterial fluorescent staining technique and is used for detecting dyed salmonella typhimurium via immunochromatography by utilizing a single antibody. The test paper box comprises a single antibody test strip and a fluorochrome box. The test paper box has the advantages that the salmonella typhimurium is dyed in advance by utilizing fluorochrome and then is sprayed on a T line of the test strip by utilizing a specific antibody of the salmonella typhimurium so as to capture the salmonella typhimurium in a mixed sample, so that the salmonella typhimurium in the sample can be rapidly and specifically detected.
Owner:NANCHANG UNIV

Fluorescent immunochromatography detection method and detection test paper of salmonella typhimurium

The invention provides a detection test strip of salmonella typhimurium. The detection test strip comprises a sample pad, a cellulose nitrate membrane, absorbent paper and a bottom plate. A quantum dot fluorescent micro-sphere is marked with a monoclonal antibody of salmonella typhimurium, and the cellulose nitrate membrane is coated with a detection antibody and a quality control antibody. Basedon the test strip, the invention also provides a method for high-sensitivity and quick quantitative detection of salmonella typhimurium. The method fully utilizes super-strong and stable fluorescent signals of quantum dots, combines the advantages of easy marking and control of polymer sub-micro-spheres, constructs an immunochromatography technology of quantum dot fluorescent micro-spheres, and realizes sensitive and quick detection of salmonella typhimurium.
Owner:WUHAN ACADEMY OF AGRI SCI

Primers, probes, a test kit and a test method for triple real-time fluorescence PCR detection of four bacteria

The invention discloses primers, probes, a test kit and a test method for triple real-time fluorescence PCR detection of Salmonella choleraesuis, Salmonella paratyphi, Salmonella typhi, and Salmonella gallinarum. According to the present invention, a triple real-time PCR method is used, wherein a consensus sequence of Salmonella choleraesuis and Salmonella paratyphi is used for the detection of Salmonella choleraesuis and Salmonella paratyphi, a specific sequence of Salmonella typhi is used for the detection of Salmonella typhi, and a specific sequence of Salmonella gallinarum is used for the detection of Salmonella gallinarum. Whether a sample is contaminated by Salmonella choleraesuis, Salmonella paratyphi, Salmonella typhi, and Salmonella gallinarum is determined via a real-time fluorescence PCR amplification, and then Salmonella choleraesuis and Salmonella paratyphi are distinguished via a single fluorescent PCR amplification; the detection is rapid, the process of preparing sample and issuing test results can be finished in 31hours, the results are reliable, and sensitivity and specificity are high.
Owner:许龙岩 +5

Primer, probe and chip for detecting and identifying salmonella typhosa nucleic acid segment

The invention discloses a primer, a probe and a chip for detecting and identifying a salmonella typhosa nucleic acid segment. The primer sequence comprises a primer pair sequence comprising an upstream primer sequence shown in SEQ ID NO.2 and a downstream primer sequence shown in SEQ ID NO.3. The probe sequence comprises 5'-Zc-P-3', wherein Zc at the 5' end is a sequence complementary to a probe Z fixed on a gene chip, and P at the 3' end is a specific sequence of a salmonella typhosa gene shown in SEQ ID NO.4. The gene chip comprises a probe for detecting and identifying the salmonella typhosa nucleic acid segment and a probe Z fixed on a solid-phase carrier. The primer, the probe and the chip provided by the invention can specifically and purposively detect the salmonella typhosa.
Owner:SHANGHAI BIOCHIP

Staphylococcus aureus capsular polysaccharide and protein conjugate and preparation method and application thereof

The invention discloses a staphylococcus aureus capsular polysaccharide and protein conjugate and preparation method and application thereof. Salmonella typhimurium flagellin or polylysine salmonella typhimurium flagellin is taken as a carrier, and staphylococcus aureus capsular polysaccharide is subject to chemical modification, and then chemical coupling is carried out on the staphylococcus aureus capsular polysaccharide and the carrier protein. As the salmonella typhimurium flagellin and polylysine salmonella typhimurium flagellin have immunologic adjuvant function, the new formed conjugate can cause staphylococcus aureus capsular polysaccharide with extremely low immunogenicity to have higher immunogenicity, and the carrier protein plays the immunologic adjuvant function when in inoculation, so that specific immune response of immune animal to the staphylococcus aureus capsular polysaccharide is enhanced. The invention has wide application in preparation of vaccine resisting staphylococcus aureus infection.
Owner:ZHEJIANG UNIV

Bifidobacterium animalis as well as preparation and application thereof

The invention relates to bifidobacterium animalis which is resistant to acid and cholate, can survive at 15-25 DEG C, can regulate intestinal microbial flora and has an inhibiting effect on escherichia coli, salmonella typhimurium and staphylococcus aureus. The bifidobacterium animalis is preserved in CGMCC, has a preservation number of CGMCC No.19827, has the effects of increasing the number of lactic acid bacteria in intestinal tracts and reducing the number of escherichia coli, and can grow in cooperation with lactobacillus rhamnosus CGMCC NO.19826 and lactobacillus plantarum CGMCC NO.19825to jointly regulate the intestinal microbial flora.
Owner:中科美大(福建)生物科技有限公司

Bacteriophage of the siphoviridae family and antibacterial compositions comprising the same

The present invention relates to a novel bacteriophage, more particularly, a bacteriophage that has a specific bactericidal activity against Salmonella enteritidis, Salmonella typhimurium, Salmonella gallinarum and Salmonella pullorum, a composition for the prevention or treatment of infectious diseases including salmonellosis and Salmonella food poisoning caused by Salmonella enteritidis or Salmonella typhimurium, Fowl typhoid caused by Salmonella gallinarum, and Pullorum disease caused by Salmonella pullorum, which comprises the bacteriophage as an active ingredient, and an animal feed, drinking water, cleaner, and sanitizer which comprise the bacteriophage as an active ingredient.
Owner:CJ CHEILJEDANG CORP

Novel specific molecular targets for 16 different serotypes of salmonella and rapid detection method thereof

The invention discloses specific novel molecular targets of 16 different serotypes of salmonella and a rapid detection method of the specific novel molecular targets. The invention provides a method for detecting salmonella enteritidis, which is used for different serotypes of salmonella. The invention method provides 72 specific molecular detection targets for different serotypes of salmonella including salmonella enteritidis, salmonella typhimurium, salmonella derby, salmonella indiana, salmonella agona, salmonella infantis, salmonella rissen, salmonella braenderup, salmonella virehow , salmonella albany, salmonella hadar, salmonella weltevreden, salmonella London, salmonella meleagridis, salmonella senftenberg and salmonella pomona, and corresponding PCR primer groups and a rapid detection method. The method provided by the invention has the advantages of short detection time, low cost, simple operation and strong specificity; meanwhile, the detection method can be used for detecting some strains with unexpressed antigens, avoiding the defects of immunodetection, and is more accurate in detection result, simpler in judgment and higher in practicability.
Owner:GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY +1

Live, oral vaccine for protection against Shigella dysenteriae serotype 1

ActiveUS8071113B2Antibacterial agentsBiocideO antigen biosynthesisShigella dysenteriae
The invention relates to Salmonella typhi Ty21a comprising core-linked Shigella dysenteriae serotype 1 O-specific polysaccharide (O-Ps) and DNA encoding O antigen biosynthesis, said DNA selected from the group consisting of: a) the DNA sequence set out in any one of SEQ ID NOs: 1 and 2 and species homologs thereof; b) DNA encoding Shigella dysenteriae serotype 1 polypeptides encoded by any one of SEQ ID NOs: 1 and 2, and species homologs thereof; and c) DNA encoding a O antigen biosynthesis gene product that hybridizes under moderately stringent conditions to the DNA of (a) or (b); and related sequences, compositions of matter, vaccines, methods of using, and methods of making.
Owner:UNITED STATES OF AMERICA

Salmonella phage LPST144 and antibacterial application of lyase of salmonella phage LPST144

The invention discloses a salmonella phage LPST144 and antibacterial application of a lyase of the salmonella phage LPST144. The phage is called after Salmonella Typhimurium Bacteriophage LPST144. Thesalmonella phage LPST144 disclosed by the invention and the lyase LysT15 thereof can crack salmonella; through specifically cracking the salmonella by employing the phage and the lyase thereof, the salmonella can be prevented from evolving, and the generation of drug-resistant strains is reduced; both the phage strain disclosed by the invention and the lyase thereof have hydrophilic phases, and spraying solutions or eluents are very easily prepared through the traditional method so as to disinfect environments or utensils; and the phage disclosed by the invention and the lyase thereof are free of toxic or side effects, can serve as food additives and have potential applications in dealing with food contamination.
Owner:HUAZHONG AGRI UNIV