Detection kit of H9 subtype of avian influenza virus and application thereof
A bird flu virus and kit technology, applied in the field of H9 subtype bird flu virus detection kits, can solve the problems of complex operation, expensive equipment, time-consuming, etc., and achieve the effect of simple and convenient operation, high specificity and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Embodiment 1, the preparation of H9 subtype avian influenza virus detection kit
[0049] 1. Synthesis of primers
[0050] Artificially synthesize the following 3 pairs of primers (5'→3'):
[0051] F3: TGTTTCGAGCTATACCACAA (sequence 2 of the sequence listing);
[0052] B3: CCCAGAACAAGAAGGCAG (sequence 3 of the sequence listing);
[0053] FIP: GATTCCTCTTGATACTTCCTCCTTTTGTGATGACCAGTGCATGG (SEQ ID NO: 4 of the SEQUENCE LISTING);
[0054] BIP: GTCAAGCTGGAGTCTGAAGGAACTTTTCACAAGAGATGAGGCGAC (SEQ ID NO: 5 of the SEQUENCE LISTING);
[0055] LF: TAGGTCCCATTCCGAATTGTCT (Sequence 6 of the Sequence Listing);
[0056] LB: ACAAAATCCTCACCATTTATTCGAC (SEQ ID NO: 7 of the Sequence Listing).
[0057] 2. Preparation of sample tube
[0058] A commercially available 0.6ml centrifuge tube (requiring no nucleic acid contamination) was loaded into a 1.2mm diameter FTA card (Whatman, Cat No. WB120205) cut with a hole punch to obtain a sample tube.
[0059] 3. Preparation of positive contr...
Embodiment 2
[0066] Embodiment 2, the preparation of H9 subtype avian influenza virus detection kit
[0067] 1. Synthesis of primers
[0068] Same as Step 1 of Example 1.
[0069] 2. Preparation of reaction tube
[0070] Same as Step 2 of Example 1.
[0071] 3. Preparation of positive control
[0072] Same as Step 3 of Example 1.
[0073] 4. Preparation of LAMP reaction solution
[0074] Solution A is composed of solute and solvent; the solvent is double distilled water; the solute and its concentration are as follows: KCl is 16.67nmol / μl, MgSO 4 .7H 2 O is 13.33nmol / μl, (NH 4 ) 2 SO 4 16.67nmol / μl, calcein is 0.083nmol / μl, MnCl 2 4H 2 O is 1nmol / μl, each dNTPs is 2.33nmol / μl, betaine (Betaine) is 0.33μmol / μl, Tris-HCl (added in the form of 1M pH8.8 Tris-HCl) is 33.33nmol / μl, Tween- 20 is 0.17% (volume percentage), F3 is 0.28pmol / μl, B3 is 0.28pmol / μl, FIP is 2.22pmol / μl, BIP is 2.22pmol / μl, LF is 1.11pmol / μl, LB is 1.11pmol / μl.
[0075] Solution B is composed of solute and ...
Embodiment 3
[0078] Embodiment 3, the preparation of H9 subtype avian influenza virus detection kit
[0079] 1. Synthesis of primers
[0080] Same as Step 1 of Example 1.
[0081] 2. Preparation of reaction tube
[0082] Same as Step 2 of Example 1.
[0083] 3. Preparation of positive control
[0084] Same as Step 3 of Example 1.
[0085] 4. Preparation of LAMP reaction solution
[0086] Solution A is composed of solute and solvent; the solvent is double distilled water; the solute and its concentration are as follows: KCl is 16.67nmol / μl, MgSO 4 .7H 2 O is 13.33nmol / μl, (NH 4 ) 2 SO 4 16.67nmol / μl, calcein is 0.083nmol / μl, MnCl 2 4H 2 O is 1nmol / μl, each dNTPs is 2.33nmol / μl, betaine (Betaine) is 0.33μmol / μl, Tris-HCl (added in the form of 1M pH8.8 Tris-HCl) is 33.33nmol / μl, Tween-20 0.17% (volume percentage content), F3 is 0.39pmol / μl, B3 is 0.39pmol / μl, FIP is 3.11pmol / μl, BIP is 3.11pmol / μl, LF is 1.55pmol / μl, LB is 1.55pmol / μl μl.
[0087] Solution B is composed of solut...
PUM
Property | Measurement | Unit |
---|---|---|
Diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com