Check patentability & draft patents in minutes with Patsnap Eureka AI!

Detection kit of H9 subtype of avian influenza virus and application thereof

A bird flu virus and kit technology, applied in the field of H9 subtype bird flu virus detection kits, can solve the problems of complex operation, expensive equipment, time-consuming, etc., and achieve the effect of simple and convenient operation, high specificity and high sensitivity

Inactive Publication Date: 2011-07-13
CHINA AGRI UNIV
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above methods have different disadvantages, such as complicated operation, time-consuming, expensive equipment, etc., and are not suitable for grassroots applications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit of H9 subtype of avian influenza virus and application thereof
  • Detection kit of H9 subtype of avian influenza virus and application thereof
  • Detection kit of H9 subtype of avian influenza virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Embodiment 1, the preparation of H9 subtype avian influenza virus detection kit

[0049] 1. Synthesis of primers

[0050] Artificially synthesize the following 3 pairs of primers (5'→3'):

[0051] F3: TGTTTCGAGCTATACCACAA (sequence 2 of the sequence listing);

[0052] B3: CCCAGAACAAGAAGGCAG (sequence 3 of the sequence listing);

[0053] FIP: GATTCCTCTTGATACTTCCTCCTTTTGTGATGACCAGTGCATGG (SEQ ID NO: 4 of the SEQUENCE LISTING);

[0054] BIP: GTCAAGCTGGAGTCTGAAGGAACTTTTCACAAGAGATGAGGCGAC (SEQ ID NO: 5 of the SEQUENCE LISTING);

[0055] LF: TAGGTCCCATTCCGAATTGTCT (Sequence 6 of the Sequence Listing);

[0056] LB: ACAAAATCCTCACCATTTATTCGAC (SEQ ID NO: 7 of the Sequence Listing).

[0057] 2. Preparation of sample tube

[0058] A commercially available 0.6ml centrifuge tube (requiring no nucleic acid contamination) was loaded into a 1.2mm diameter FTA card (Whatman, Cat No. WB120205) cut with a hole punch to obtain a sample tube.

[0059] 3. Preparation of positive contr...

Embodiment 2

[0066] Embodiment 2, the preparation of H9 subtype avian influenza virus detection kit

[0067] 1. Synthesis of primers

[0068] Same as Step 1 of Example 1.

[0069] 2. Preparation of reaction tube

[0070] Same as Step 2 of Example 1.

[0071] 3. Preparation of positive control

[0072] Same as Step 3 of Example 1.

[0073] 4. Preparation of LAMP reaction solution

[0074] Solution A is composed of solute and solvent; the solvent is double distilled water; the solute and its concentration are as follows: KCl is 16.67nmol / μl, MgSO 4 .7H 2 O is 13.33nmol / μl, (NH 4 ) 2 SO 4 16.67nmol / μl, calcein is 0.083nmol / μl, MnCl 2 4H 2 O is 1nmol / μl, each dNTPs is 2.33nmol / μl, betaine (Betaine) is 0.33μmol / μl, Tris-HCl (added in the form of 1M pH8.8 Tris-HCl) is 33.33nmol / μl, Tween- 20 is 0.17% (volume percentage), F3 is 0.28pmol / μl, B3 is 0.28pmol / μl, FIP is 2.22pmol / μl, BIP is 2.22pmol / μl, LF is 1.11pmol / μl, LB is 1.11pmol / μl.

[0075] Solution B is composed of solute and ...

Embodiment 3

[0078] Embodiment 3, the preparation of H9 subtype avian influenza virus detection kit

[0079] 1. Synthesis of primers

[0080] Same as Step 1 of Example 1.

[0081] 2. Preparation of reaction tube

[0082] Same as Step 2 of Example 1.

[0083] 3. Preparation of positive control

[0084] Same as Step 3 of Example 1.

[0085] 4. Preparation of LAMP reaction solution

[0086] Solution A is composed of solute and solvent; the solvent is double distilled water; the solute and its concentration are as follows: KCl is 16.67nmol / μl, MgSO 4 .7H 2 O is 13.33nmol / μl, (NH 4 ) 2 SO 4 16.67nmol / μl, calcein is 0.083nmol / μl, MnCl 2 4H 2 O is 1nmol / μl, each dNTPs is 2.33nmol / μl, betaine (Betaine) is 0.33μmol / μl, Tris-HCl (added in the form of 1M pH8.8 Tris-HCl) is 33.33nmol / μl, Tween-20 0.17% (volume percentage content), F3 is 0.39pmol / μl, B3 is 0.39pmol / μl, FIP is 3.11pmol / μl, BIP is 3.11pmol / μl, LF is 1.55pmol / μl, LB is 1.55pmol / μl μl.

[0087] Solution B is composed of solut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a detection kit of H9 subtype of avian influenza virus and an application thereof. The kit provided by the invention contains three pairs of primers, namely an inner primer pair, an outer primer pair and an annular primer pair which combine with the HA gene of the H9 subtype of avian influenza virus. The detection kit disclosed by the invention has high detection sensitivity, thus 100.5 EID50 of virus can be detected; and the detection kit is simple and convenient to operate and is especially suitable for the on-site clinical medical detection in primary-level and the food detection of H9 subtype of avian influenza virus.

Description

technical field [0001] The invention relates to a detection kit for H9 subtype avian influenza virus and its application. Background technique [0002] Avian influenza is a kind of severe infectious disease of poultry caused by avian influenza A virus (Influenza A virus) of the family Orthomyxoviridae. According to the antigenicity of hemagglutinin and neuraminidase, it can be divided into 16 H subtypes (H1-H16) and 9 N subtypes (N1-N9). In 1966, the H9 subtype avian influenza virus was isolated for the first time in the United States, and then it was reported in mainland China, Hong Kong, South Korea, the Middle East, Europe, North America and other countries and regions. After the H9 subtype avian influenza virus was isolated in mainland China for the first time in 1994, it began to spread widely, causing certain economic losses to the poultry industry. [0003] Infection of poultry with H9 subtype avian influenza virus, especially when accompanied by mixed infection, ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70
Inventor 吴文学蒋菲黄书林张跃伟
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More