Novel phagemid display vector pCANTAB5M
A phagemid and vector technology, which can be applied to viruses/phages, introduction of foreign genetic material using vectors, recombinant DNA technology, etc., can solve problems such as improvement, increase of operation steps, waste, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1: Construction of pCANTAB5M recombinant vector
[0039] 1. Primer design for linker sequence
[0040] Based on pCANTAB5E vector and pCDNA TM 3.1 / myc-His(-) vector sequence design linker sequence PCR extension primers are as follows:
[0041] MH-Sense
[0042] GCTGGCTTAGTCTTGGCCTTCTCGGCCCTCTAGACTCGAGAGGCCTCC
[0043] MH-Antisense
[0044] TTTTCCTTTTGCGGCCGCTAGAAGGCACAGTCGAGGCTGATCAGCGGT
[0045] 2. Amplification of the linker sequence
[0046] pcDNA TM 3.1 / myc-His(-) plasmid was used as a template, and the linker sequence was amplified with MH-Sense and MH-Antisense primers. While amplifying, due to the introduction of the gene sequence of the Stu I restriction site in the primer, the pcDNA TM 3.1 / myc-His(-) The original Not I restriction site of the vector was mutated into a Stu I restriction site, and through amplification, four restriction enzymes including Xba I, Stu I, EcoRV and Kpn I were obtained Site, linker sequence of myc, His tag and BGH u...
Embodiment 2
[0060] Example 2: Identification of the pCANTAB5M carrier tag
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
