Unlock instant, AI-driven research and patent intelligence for your innovation.

Novel phagemid display vector pCANTAB5M

A phagemid and vector technology, which can be applied to viruses/phages, introduction of foreign genetic material using vectors, recombinant DNA technology, etc., can solve problems such as improvement, increase of operation steps, waste, etc.

Inactive Publication Date: 2012-09-19
BIOTECH PHARMA CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] However, this vector still has some defects. The restriction endonuclease sites used by the pCANTAB5E vector itself are Not I and Sfi I, which brings a lot of adverse effects to the subsequent antibody library construction and library capacity improvement.
First of all, because the optimal action temperature of the two restriction endonucleases is different, it leads to an increase in the operation steps in the operation process, which is not conducive to the improvement of the antibody library storage capacity, and causes unnecessary waste; secondly, the Not I enzyme The cleavage site is a restriction endonuclease site with relatively high G (guanylic acid) and C (cytosine) content, so excessive enzymes and a long time are required to achieve the desired effect during enzyme cleavage; Finally, Sfi I is an enzyme with a site-dominant effect, and its digestion efficiency is not high. Therefore, it is very important to modify the pCANTAB5E vector to make it more suitable for the construction of phage antibody libraries.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel phagemid display vector pCANTAB5M
  • Novel phagemid display vector pCANTAB5M
  • Novel phagemid display vector pCANTAB5M

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1: Construction of pCANTAB5M recombinant vector

[0039] 1. Primer design for linker sequence

[0040] Based on pCANTAB5E vector and pCDNA TM 3.1 / myc-His(-) vector sequence design linker sequence PCR extension primers are as follows:

[0041] MH-Sense

[0042] GCTGGCTTAGTCTTGGCCTTCTCGGCCCTCTAGACTCGAGAGGCCTCC

[0043] MH-Antisense

[0044] TTTTCCTTTTGCGGCCGCTAGAAGGCACAGTCGAGGCTGATCAGCGGT

[0045] 2. Amplification of the linker sequence

[0046] pcDNA TM 3.1 / myc-His(-) plasmid was used as a template, and the linker sequence was amplified with MH-Sense and MH-Antisense primers. While amplifying, due to the introduction of the gene sequence of the Stu I restriction site in the primer, the pcDNA TM 3.1 / myc-His(-) The original Not I restriction site of the vector was mutated into a Stu I restriction site, and through amplification, four restriction enzymes including Xba I, Stu I, EcoRV and Kpn I were obtained Site, linker sequence of myc, His tag and BGH u...

Embodiment 2

[0060] Example 2: Identification of the pCANTAB5M carrier tag

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a novel phagemid display vector pCANTAB5M and a preparation method as well as application thereof. The vector is formed by improving a commercial vector pCANTAB5E, inserting four common incision enzyme cloning sites, i.e., Xba I, Stu I, EcoRV and Kpn I between enzyme cutting sites of Sfi I and Not I and simultaneously introducing a Myc label, a His label and a general sequencing primer BGH in the vector. Due to such improvement, directional cloning operation of exogenous genes is simplified, and the storage capacity and the cloning efficiency are improved, so that the identification of positive phagemid cloning is more accurate, and sequencing verification work of positive cloning is greatly facilitated. The novel phagemid display vector pCANTAB5M is suitable for displaying various random peptide libraries, antibody libraries and various functional target proteins.

Description

technical field [0001] The invention relates to the technical field of antibody engineering, in particular to a novel phagemid display carrier applied to phage display technology. Background technique [0002] Phage display technology is currently the most widely used molecular display technology. It uses bacterial viruses, such as filamentous phage M13, as carriers to organically combine genes and gene products. The basic principles of other display systems derived from this are the same, but the vector and host cells are different. [0003] In 1985, Smith GP of the University of Missouri in the United States inserted a foreign gene into the genome of a filamentous bacteriophage (Filamentous bacteriophage, fd) for the first time, so that the polypeptide encoded by the target gene was displayed in the form of a fusion protein, thus creating the phage display technology (Smith GP , Science, 1985, 228(4705): 1315-1317). In 1994, McCaffery et al first constructed a phage anti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N7/01
Inventor 尹琪白先宏王康马金伟刘方杰刘志刚
Owner BIOTECH PHARMA CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More